IGEM:Hong Kong HKUST/Primers

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(New page: EcoRI_T7P: GC GAA TTC TAATACGACTCACTATAGGG 4_XhoI: 7_followup_1: 7_followup_2: 19_new_up: 20_up: 21_up:)
Line 1: Line 1:
EcoRI_T7P: GC GAA TTC  TAATACGACTCACTATAGGG
EcoRI_T7P: GC GAA TTC  TAATACGACTCACTATAGGG
 +
4_XhoI:  
4_XhoI:  
 +
7_followup_1:
7_followup_1:
 +
7_followup_2:
7_followup_2:
 +
19_new_up:
19_new_up:
 +
20_up:
20_up:
 +
21_up:
21_up:
 +
 +
 +
{|cellspacing="1" width=100%
 +
! style="background:#003E81; color: white" colspan="5" | Primers
 +
|-style="background:#66FFCC" align="center"
 +
| width=5% | Number
 +
| width=5% | Name
 +
| width=10% | Sequence
 +
| width=5% | Tm
 +
| width=5% | Date
 +
...
 +
|}

Revision as of 08:04, 13 October 2008

EcoRI_T7P: GC GAA TTC TAATACGACTCACTATAGGG

4_XhoI:

7_followup_1:

7_followup_2:

19_new_up:

20_up:

21_up:


Primers
Number Name Sequence Tm Date

...

Personal tools