IGEM:Hong Kong HKUST/Primers

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(New page: EcoRI_T7P: GC GAA TTC TAATACGACTCACTATAGGG 4_XhoI: 7_followup_1: 7_followup_2: 19_new_up: 20_up: 21_up:)
Line 1: Line 1:
{|cellspacing="1" width=100%
! style="background:#003E81; color: white" colspan="5" | Primers
|-style="background:#66FFCC" align="center"
| width=5% | Number
| width=5% | Name
| width=10% | Sequence
| width=5% | Tm
| width=5% | Date

Revision as of 09:04, 13 October 2008








Number Name Sequence Tm Date


Personal tools