
From OpenWetWare

< IGEM:Harvard | 2006 | Adaptamers
Revision as of 15:03, 21 August 2006 by Lhahn (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search



  • Oligos (8 ssDNA sequences):

SN = streptavidin aptamer + N bp 3' tail

TN = thrombin aptamer + N bp 3' tail

















  • Alignment


3'                                              TCGTAGATCTCCAAGTCACAGGTTGGTGTGGTTGG    5'


3'                                              TCGTAGATCTCCAAGTGAAGACGTCGTTATTCACAGGTTGGTGTGGTTGG      5'        


















  • Alignment







Biotinylated oligos

Biotinylated oligos as positive control in viscosity experiment:

5' and 3' biotinylated:



5' biotinylated:





Strand Displacement Oligos









Personal tools