IGEM:Harvard/2006/DNA nanostructures/Notebook/2006-7-26

Gel purification

gel purified nanoboxes design 3.2.D and 3.2.E (lanes 3 and 4) - not great yield

Gel Image

Goals and questions

Goals

• continue to evaluate the best way to purify nanostructures away from oligos
  • run gel of gel purification products
  • titrate PEG concentrations
• get streptavidin to stain!

Questions

• can streptavidin stain with silver stain (and so we're doing something wrong), or do we need to find a new stain?
• can we implement an EcoRI restriction of DNA cleavage instead?
  • does the p7308 scaffold have any EcoRI restriction sites?
  • how long should an oligo be?
  • under what conditions can we visualize a short ss oligo?
    • SYBR Gold
    • adding a complimentary DNA

Oligo design

Random generation script

In accordance with the design above, this code generates 39 random nucleotides (free of NotI sites), appends an NotI site, appends four thymine nucleotides, appends another NotI site, appends four more thymine nucleotides, then appends the reverse compliment of the thrombin aptamer. It was adapted from |random sequence generator and restriction site checker.

One program output:

ATGCTGAGGGTGAGCCCCTACTCGTCGTCAACAATTTCAGCGGCCGCTTTTGCGGCCGCTTTTCCAACCACACCAACC

The code:

#!/usr/bin/python

import random
import sys
import string

BamHI = 'ggatcc'
EcoRI = 'gaattc'
aptamer = 'GGTTGGTGTGGTTGG'

def rev(s):
  return s[::-1]
complement = string.maketrans('ACGTacgt','TGCAtgca')
def comp(s):
  return rev(s.translate(complement))

def hasresite(s):
  
  result = False

  if s.count(BamHI) > 0:
    print 'BamHI found'
    result = True
  elif s.count(EcoRI) > 0:
    print 'EcoRI found'
    result = True
  
  return result

# prints random sequence, length specified as argument

def randseq(l):
    flag = True
    s = []
    while (flag == True):
        s = []
        for i in range(l):
            s.append(random.choice(['a', 'c', 'g', 't']))
        flag = hasresite(''.join(s))
    return ''.join(s)

#if len(sys.argv) > 1:
#  a = int(sys.argv[1])
#else:
#  sys.exit("usage: ./random-sequence.py [length]")

final_seq = []
final_seq.append(randseq(39))
final_seq.append(EcoRI)
final_seq.append('tttt')
final_seq.append(EcoRI)
final_seq.append('tttt')
final_seq.append(comp(aptamer))

print ''.join(final_seq).upper()