IGEM:Harvard/2006/DNA nanostructures/Notebook/2006-7-31

Folding & Analysis of design 5

• Folding
• Mix the following, for each of .1 to .5 (v1 and v2):
  • 4 uL 500 mM HEPES pH 7.5, 500 mM NaCl, 100 mM MgCl2
  • 16 uL working stock 250 nM each oligo (100 nM each oligo final concentration)
  • 20 uL p7392 20 nM (10 nM final concentration)
• Anneal from 80°C to 20°C, -1°C per min

2% agarose gel, 0.5 mg/mL EtBr
0.5x TBE, 11 mM MgCl₂

Lane	Contents	Loading Buffer
0	1kb DNA ladder (4 μL)
1	naked p7308 (12.5 μL)	AGLB (4 μL)
2	c5.0 barrel (12.5 μL)	AGLB (4 μL)
3	naked p7704 (12.5 μL)	AGLB (4 μL)
4	c5.0 lids (12.5 μL)	AGLB (4 μL)

• Initial folding experiments of Design 5 barrel and lids
• Barrel
  • Used p7308 scaffold for barrel, as designed
  • Two bands are visible - one brighter band running at slightly faster mobility than naked scaffold, and a second more faint band running running slower, possibly indicating some dimization of the barrels.
• Lids
  • Used p7704 scaffold because p7572 isn't yet available (should be able to make some by end of Tuesday
  • significant amount of smearing is present, and high-molecular weight species are being retained at the top of the well
  • two slight bands are visible within the smear (again may be monomeric and dimeric species), hopefully indicating that some percentage is properly folded
  • will repeat with p7572 scaffold, possibly decrementing temperature -1°C per 2 min

Redesigning the DNA ligand

It turns out that NotI requires 10bp on each side of the restriction site for succesful digests. George also suggested that we include the restriction site on the double-stranded site of binding between the nanostructure and the oligo, because hairpins could constrain enzyme binding.

We need to redesign the old DNA ligand.

Restriction site choice

Other possible restriction enzymes are listed below. Verified that restriction site does not exist in p7308 using "find" function in Notepad. Minimum number of bp on each side is from NEB chart. Molecular weights and chain lengths are from NEB product technical support (1-800-632-7799).

• AflIII (ACATGT)
  • sequence not present in p7308
  • >90% yield after 2 hr digest with 2 bp on each side
  • 26,954 Da (233 aa)
• AscIII (GGCGCGCC)
  • sequence not present in p7308
  • >90% yield after 2 hr digest with 0 bp on each side
  • 50,466 Da (455 aa)
• StuI (AGGCCT)
  • sequence not present in p7308
  • >90% yield after 2 hr digest with 1 bp on each side
  • 28,518 Da (255 aa)

None of these enzymes has confirmed star activity.

It's advantageous to choose the largest enzyme (least likely to fit into the nanostructure), so we choose AscIII.

Schematic

Random generation script

A sample output:

GTCAGCTGAGCTTCTTAGGCAACGTCCGAACGGGCGCGCCTCCAT

The script, which was adopted from an earlier version:

#!/usr/bin/python

import random
import sys
import string

BamHI = 'ggatcc'
EcoRI = 'gaattc'
NotI = 'gcggccgc'
AscI = 'ggcgcgcc'
aptamer = 'GGTTGGTGTGGTTGG'

def rev(s):
  return s[::-1]
complement = string.maketrans('ACGTacgt','TGCAtgca')
def comp(s):
  return rev(s.translate(complement))

def hasresite(s):
  
  result = False

  if s.count(BamHI) > 0:
    print 'BamHI found'
    result = True
  elif s.count(EcoRI) > 0:
    print 'EcoRI found'
    result = True
  elif s.count(NotI) > 0:
    print 'NotI found'
    result = True
  elif s.count(AscI) > 0:
    print 'NotI found'
    result = True
  
  return result

# prints random sequence, length specified as argument

def randseq(l):
    flag = True
    s = []
    while (flag == True):
        s = []
        for i in range(l):
            s.append(random.choice(['a', 'c', 'g', 't']))
        flag = hasresite(''.join(s))
    return ''.join(s)

#if len(sys.argv) > 1:
#  a = int(sys.argv[1])
#else:
#  sys.exit("usage: ./random-sequence.py [length]")

final_seq = []

##oligo design 1
#final_seq.append(randseq(39))
#final_seq.append(NotI)
#final_seq.append('tttt')
#final_seq.append(NotI)
#final_seq.append('tttt')
#final_seq.append(comp(aptamer))

## oligo design 2
final_seq.append(randseq(32))
final_seq.append(AscI)
final_seq.append(randseq(5))

final_seq = ''.join(final_seq).upper()

print final_seq

PEG precipitations

Used PEG precipitation protocol for reagents shown for lanes 5-20. Pellet lanes: reconstituted pellet in 10 μL folding buffer and loaded it all. Supernatant lanes: loaded 10 μL supernatant.

lane	folding reaction (μL)	20% peg / 2.5 M NaCl (μL)	water (μL)	final PEG concentration	pellet/supernatant
1	1 kb+ ladder
2	10	0	0	0%
3	10 (6hb)	20	10	10%	pellet
4	10 (6hb)	20	10	10%	supernatant
5	10	12	18	6%	pellet
6	10	12	18	6%	supernatant
7	10	16	14	8%	pellet
8	10	16	14	8%	supernatant
9	10	20	10	10%	pellet
10	10	20	10	10%	supernatant
11	10	22	8	11%	pellet
12	10	22	8	11%	supernatant
13	10	24	6	12%	pellet
14	10	24	6	12%	supernatant
15	10	26	4	13%	pellet
16	10	26	4	13%	supernatant
17	10	28	2	14%	pellet
18	10	28	2	14%	supernatant
19	10	30	0	15%	pellet
20	10	30	0	15%	supernatant

Gel purification of nanostructures

• using new buffer. added to the buffer 1 mL of 1M MgCl2 per 100 mL buffer
• using 20ul of folded structure.
• trying both design 3 and design 4
• using scaffold as a control (to hopefully varify we're cutting out nanostructures), but we know roughly where the nanostructures run to in any case.

Ordered Latches for c5.0

c5.0.10: Barrel Latches
c5.0.11: Barrel Splits (ie. portion of oligo that had to be split off from the latch to allow addition of latch sequence )
c5.0.12: Barrel Zipper Oligos

c5.0.13: Top Lid Latches
c5.0.14: Top Lid Splits
c5.0.15: Top Lid Zipper Oligos

c5.0.16: Bottom Lid Latches
c5.0.17: Bottom Lid Splits
c5.0.18: Bottom Lid Zipper Oligos

c5.0.19: Barrel Displacement Latches
c5.0.20: Top Lid Displacement Latches
c5.0.21: Bottom Lid Displacement Latches