IGEM:Harvard/2006/DNA nanostructures/Notebook/2006-8-7: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
| Line 13: | Line 13: | ||
Mix together, in order: | Mix together, in order: | ||
* 998 fmols (14.0 ng) ligand DNA (MW = 14,027 Da [http://www.changbioscience.com/genetics/mw.html]) = 1 {{ul}} 1 {{um}} | * 998 fmols (14.0 ng) ligand DNA (MW = 14,027 Da [http://www.changbioscience.com/genetics/mw.html]) = 1 {{ul}} 1 {{um}} | ||
** 45 nt: TAAAGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG | |||
* 1 pmol (11.3 ng) attachment DNA c4.0.6.1.ob (MW = 11,259.3 Da) = 1 {{ul}} 1 {{um}} | * 1 pmol (11.3 ng) attachment DNA c4.0.6.1.ob (MW = 11,259.3 Da) = 1 {{ul}} 1 {{um}} | ||
** 37 nt: AAGGCTCCGATCTATTTTTTTTCCGCGGGCGCGCCCC | |||
* 2 {{ul}} 10x BSA | * 2 {{ul}} 10x BSA | ||
* 2 {{ul}} 10x NEBuffer 4 [http://www.neb.com/nebecomm/products/productR0558.asp] | * 2 {{ul}} 10x NEBuffer 4 [http://www.neb.com/nebecomm/products/productR0558.asp] | ||
| Line 26: | Line 28: | ||
Incubate samples at 37{{c}} for specified time. Run on an 18% PA gel. | Incubate samples at 37{{c}} for specified time. Run on an 18% PA gel. | ||
* expected ss sizes | |||
** 34 nt, 11 nt (digested ligand) | |||
** 29 nt, 8 nt (digested attachment DNA) | |||
** 45 nt (undigested ligand) | |||
** 37 nt (undigested attachment DNA) | |||
Revision as of 11:37, 7 August 2006
AscI digestion protocol proposal
adopted from Wednesday's proposal
Initial test, just oligos
Start by trying to digest ~25 ng DNA.
1 unit = enough enzyme to digest 1 μg DNA at 37[[:Category:{{{1}}}|{{{1}}}]] in 1 h in a total reaction volume of 50 μL [1]
- = enough enzyme to digest 5 μg DNA at 37[[:Category:{{{1}}}|{{{1}}}]] in 1 h in a total reaction volume of 10 μL
- = enough enzyme to digest 1 μg DNA at 37[[:Category:{{{1}}}|{{{1}}}]] in 12 min. in a total reaction volume of 10 μL
Mix together, in order:
- 998 fmols (14.0 ng) ligand DNA (MW = 14,027 Da [2]) = 1 μL 1 μM
- 45 nt: TAAAGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
- 1 pmol (11.3 ng) attachment DNA c4.0.6.1.ob (MW = 11,259.3 Da) = 1 μL 1 μM
- 37 nt: AAGGCTCCGATCTATTTTTTTTCCGCGGGCGCGCCCC
- 2 μL 10x BSA
- 2 μL 10x NEBuffer 4 [3]
- 25 ng DNA should require 0.025 units (25 milliunits) for a 12-minute digest. Do the following trials:
- no enzyme, 12-minute digest
- no enzyme, 24-minute digest
- 50 milliunits (1 μL 50 milliunits/μL), 12-minute digest
- 500 milliunits (1 μL 500 milliunits/μL), 12-minute digest
- 50 milliunits (1 μL 50 milliunits/μL), 24-minute digest
- 500 milliunits (1 μL 500 milliunits/μL), 24-minute digest
- water to 20 μL
Incubate samples at 37[[:Category:{{{1}}}|{{{1}}}]] for specified time. Run on an 18% PA gel.
- expected ss sizes
- 34 nt, 11 nt (digested ligand)
- 29 nt, 8 nt (digested attachment DNA)
- 45 nt (undigested ligand)
- 37 nt (undigested attachment DNA)
