IGEM:Harvard/2006/DNA nanostructures/Notebook/2006-8-7: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
No edit summary |
|||
Line 33: | Line 33: | ||
** 45 nt (undigested ligand) | ** 45 nt (undigested ligand) | ||
** 37 nt (undigested attachment DNA) | ** 37 nt (undigested attachment DNA) | ||
==MicroCon Assay== | |||
* do the following with 6hb and c5.0 barrels | |||
* reserve 40 uL (1 rxn) of folded nanostructure for gel | |||
* mix 200ul (5 rxns) of nanostructure + 200uL of dH2O | |||
** add 200uL of this dilution to Microcon sample reservoir | |||
** mark tube to be able to determine when 200uL is in it | |||
* add remaining 200uL of dilution to sample reservoir; cap | |||
* spin for 1 minute at 14,000 g (max spin speed recommended in Microcon manual) | |||
** remove from centrifuge and assess remaining liquid in sample reservoir | |||
** repeat till liquid remaining is 200uL | |||
* remove the 200uL of '''flowthrough''' at the bottom of the vial for gel | |||
** repeat 4x (until there are 5 fractions total) | |||
* for the final 200uL, reverse the sample reservoir and place into a sample-collecting vial, as instructed by the Microcon manual; pulse at 14000g | |||
* run a gel with: | |||
<pre> | |||
lane 1: 40uL original reaction | |||
lane 2: 40uL (out of 200uL) of fraction 1 of the flowthrough (should contain the bulk of the oligos) | |||
lane 3: 40uL (out of 200uL) of fraction 2 of the flowthrough | |||
lane 4: 40uL (out of 200uL) of fraction 3 of the flowthrough | |||
lane 5: 40uL (out of 200uL) of fraction 4 of the flowthrough | |||
lane 6: 40uL (out of 200uL) of fraction 5 of the flowthrough | |||
lane 7: 40uL (out of 200uL) of final "top" product (should contain the nanostructures) | |||
</pre> |
Revision as of 11:47, 7 August 2006
AscI digestion protocol proposal
adopted from Wednesday's proposal
Initial test, just oligos
Start by trying to digest ~25 ng DNA.
1 unit = enough enzyme to digest 1 μg DNA at 37[[:Category:{{{1}}}|{{{1}}}]] in 1 h in a total reaction volume of 50 μL [1]
- = enough enzyme to digest 5 μg DNA at 37[[:Category:{{{1}}}|{{{1}}}]] in 1 h in a total reaction volume of 10 μL
- = enough enzyme to digest 1 μg DNA at 37[[:Category:{{{1}}}|{{{1}}}]] in 12 min. in a total reaction volume of 10 μL
Mix together, in order:
- 998 fmols (14.0 ng) ligand DNA (MW = 14,027 Da [2]) = 1 μL 1 μM
- 45 nt: TAAAGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
- 1 pmol (11.3 ng) attachment DNA c4.0.6.1.ob (MW = 11,259.3 Da) = 1 μL 1 μM
- 37 nt: AAGGCTCCGATCTATTTTTTTTCCGCGGGCGCGCCCC
- 2 μL 10x BSA
- 2 μL 10x NEBuffer 4 [3]
- 25 ng DNA should require 0.025 units (25 milliunits) for a 12-minute digest. Do the following trials:
- no enzyme, 12-minute digest
- no enzyme, 24-minute digest
- 50 milliunits (1 μL 50 milliunits/μL), 12-minute digest
- 500 milliunits (1 μL 500 milliunits/μL), 12-minute digest
- 50 milliunits (1 μL 50 milliunits/μL), 24-minute digest
- 500 milliunits (1 μL 500 milliunits/μL), 24-minute digest
- water to 20 μL
Incubate samples at 37[[:Category:{{{1}}}|{{{1}}}]] for specified time. Run on an 18% PA gel.
- expected ss sizes
- 34 nt, 11 nt (digested ligand)
- 29 nt, 8 nt (digested attachment DNA)
- 45 nt (undigested ligand)
- 37 nt (undigested attachment DNA)
MicroCon Assay
- do the following with 6hb and c5.0 barrels
- reserve 40 uL (1 rxn) of folded nanostructure for gel
- mix 200ul (5 rxns) of nanostructure + 200uL of dH2O
- add 200uL of this dilution to Microcon sample reservoir
- mark tube to be able to determine when 200uL is in it
- add remaining 200uL of dilution to sample reservoir; cap
- spin for 1 minute at 14,000 g (max spin speed recommended in Microcon manual)
- remove from centrifuge and assess remaining liquid in sample reservoir
- repeat till liquid remaining is 200uL
- remove the 200uL of flowthrough at the bottom of the vial for gel
- repeat 4x (until there are 5 fractions total)
- for the final 200uL, reverse the sample reservoir and place into a sample-collecting vial, as instructed by the Microcon manual; pulse at 14000g
- run a gel with:
lane 1: 40uL original reaction lane 2: 40uL (out of 200uL) of fraction 1 of the flowthrough (should contain the bulk of the oligos) lane 3: 40uL (out of 200uL) of fraction 2 of the flowthrough lane 4: 40uL (out of 200uL) of fraction 3 of the flowthrough lane 5: 40uL (out of 200uL) of fraction 4 of the flowthrough lane 6: 40uL (out of 200uL) of fraction 5 of the flowthrough lane 7: 40uL (out of 200uL) of final "top" product (should contain the nanostructures)