IGEM:Harvard/2006/DNA nanostructures/Notebook/2006-8-7

AscI digestion protocol proposal

adopted from Wednesday's proposal

Initial test, just oligos

Start by trying to digest ~25 ng DNA.

1 unit = enough enzyme to digest 1 μg DNA at 37[[:Category:{{{1}}}|{{{1}}}]] in 1 h in a total reaction volume of 50 μL [1]

• = enough enzyme to digest 5 μg DNA at 37[[:Category:{{{1}}}|{{{1}}}]] in 1 h in a total reaction volume of 10 μL
• = enough enzyme to digest 1 μg DNA at 37[[:Category:{{{1}}}|{{{1}}}]] in 12 min. in a total reaction volume of 10 μL

Mix together, in order:

• 998 fmols (14.0 ng) ligand DNA (MW = 14,027 Da [2]) = 1 μL 1 μM
  • 45 nt: TAAAGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
• 1 pmol (11.3 ng) attachment DNA c4.0.6.1.ob (MW = 11,259.3 Da) = 1 μL 1 μM
  • 37 nt: AAGGCTCCGATCTATTTTTTTTCCGCGGGCGCGCCCC
• 2 μL 10x BSA
• 2 μL 10x NEBuffer 4 [3]
• 25 ng DNA should require 0.025 units (25 milliunits) for a 12-minute digest. Do the following trials:
  • no enzyme, 12-minute digest
  • no enzyme, 24-minute digest
  • 50 milliunits (1 μL 50 milliunits/μL), 12-minute digest
  • 500 milliunits (1 μL 500 milliunits/μL), 12-minute digest
  • 50 milliunits (1 μL 50 milliunits/μL), 24-minute digest
  • 500 milliunits (1 μL 500 milliunits/μL), 24-minute digest
• water to 20 μL

Incubate samples at 37[[:Category:{{{1}}}|{{{1}}}]] for specified time. Run on an 18% PA gel.

• expected ss sizes
  • 34 nt, 11 nt (digested ligand)
  • 29 nt, 8 nt (digested attachment DNA)
  • 45 nt (undigested ligand)
  • 37 nt (undigested attachment DNA)

Microcon Fractionation Trials

• Do the following with 6hb and c5.0 barrels:

• reserve 40 uL (1 rxn) of folded nanostructure for gel

• mix 200ul (5 rxns) of nanostructure + 200uL of dH2O
  • add 200uL of this dilution to Microcon sample reservoir
  • mark tube to be able to determine when 200uL is in it

• add remaining 200uL of dilution to sample reservoir; cap

• spin for 1 minute at 14,000 g (max spin speed recommended in Microcon manual)
  • remove from centrifuge and assess remaining liquid in sample reservoir
  • repeat till liquid remaining is 200uL
    • spinning down to 200uL from 400uL takes 3 min

• remove the 200uL of flowthrough at the bottom of the vial for gel
  • repeat 4x (until there are 5 fractions total)

• for the final 200uL, reverse the sample reservoir and place into a sample-collecting vial, as instructed by the Microcon manual
  • spin at 1g for 1min

• run a gel for 1hr @ 110V with:

lane 0: 10uL 1x 1kb ladder
'''c5.0'''
lane 1: 40uL original reaction
lane 2: 40uL (out of 200uL) of fraction 1 of the flowthrough (should contain the bulk of the oligos)
lane 3: 40uL (out of 200uL) of fraction 2 of the flowthrough
lane 4: 40uL (out of 200uL) of fraction 3 of the flowthrough
lane 5: 40uL (out of 200uL) of fraction 4 of the flowthrough
lane 6: 40uL (out of 200uL) of fraction 5 of the flowthrough
lane 7: 40uL (out of 200uL) of final "top" product (should contain the nanostructures)
'''6hb'''
lane 8: 40uL original reaction
lane 9: 40uL (out of 200uL) of fraction 1 of the flowthrough (should contain the bulk of the oligos)
lane 10: 40uL (out of 200uL) of fraction 2 of the flowthrough
lane 11: 40uL (out of 200uL) of fraction 3 of the flowthrough
lane 12: 40uL (out of 200uL) of fraction 4 of the flowthrough
lane 13: 40uL (out of 200uL) of fraction 5 of the flowthrough
lane 14: 40uL (out of 200uL) of final "top" product (should contain the nanostructures)

Mg2+, 1:6x Titrations for Folding

• aliquoted 20uL of each of the 6 rxns post-folding for gel
• with the other 20uL of the 6 rxns, PEG precipitated:

Added:
   20uL 20% PEG
   10uL 2.5M NaCl
Iced for 15 min
Spun at 4 deg C for 10 min
Removed supernatant (50uL) to a separate tube
Reconstituted pellet in 20uL H2O

• ran gel @ 100V for 1hr; loaded 20uL of each component with 2uL of loading dye:

lane 0: 4.5uL scaffold (44nM)
lane 1: 10nM Mg2+ final concentration, 1x oligos, PELLET
lane 2: 10nM Mg2+ final concentration, 1x oligos, SUPERNATANT
lane 3: 20nM Mg2+ final concentration, 1x oligos, PELLET
lane 4: 20nM Mg2+ final concentration, 1x oligos, SUPERNATANT
lane 5: 30nM Mg2+ final concentration, 1x oligos, PELLET
lane 6: 30nM Mg2+ final concentration, 1x oligos, SUPERNATANT
lane 7: 10nM Mg2+ final concentration, 6x oligos, PELLET
lane 8: 10nM Mg2+ final concentration, 6x oligos, SUPERNATANT
lane 9: 20nM Mg2+ final concentration, 6x oligos, PELLET
lane 10: 20nM Mg2+ final concentration, 6x oligos, SUPERNATANT
lane 11: 30nM Mg2+ final concentration, 6x oligos, PELLET
lane 12: 30nM Mg2+ final concentration, 6x oligos, SUPERNATANT
lane 13: 10uL 1x 1kb ladder