IGEM:Harvard/2006/DNA nanostructures/Notebook/2006-8-7

From OpenWetWare
Jump to navigationJump to search

AscI digestion protocol proposal

adopted from Wednesday's proposal

Initial test, just oligos

Start by trying to digest ~25 ng DNA.

1 unit = enough enzyme to digest 1 μg DNA at 37[[:Category:{{{1}}}|{{{1}}}]] in 1 h in a total reaction volume of 50 μL [1]

  • = enough enzyme to digest 5 μg DNA at 37[[:Category:{{{1}}}|{{{1}}}]] in 1 h in a total reaction volume of 10 μL
  • = enough enzyme to digest 1 μg DNA at 37[[:Category:{{{1}}}|{{{1}}}]] in 12 min. in a total reaction volume of 10 μL

Mix together, adding enzyme last:

  • 998 fmols (14.0 ng) ligand DNA (MW = 14,027 Da [2]) = 1 μL 1 μM
    • 45 nt: TAAAGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
  • 1 pmol (11.3 ng) attachment DNA c4.0.6.1.ob (MW = 11,259.3 Da) = 1 μL 1 μM
    • 37 nt: AAGGCTCCGATCTATTTTTTTTCCGCGGGCGCGCCCC
  • 2 μL 10x BSA
  • 2 μL 10x NEBuffer 4 [3]
  • 25 ng DNA should require 0.025 units (25 milliunits) for a 12-minute digest. Do the following trials:
    • no enzyme, 12-minute digest
    • no enzyme, 24-minute digest
    • 50 milliunits (1 μL 50 milliunits/μL), 12-minute digest
    • 500 milliunits (1 μL 500 milliunits/μL), 12-minute digest
    • 50 milliunits (1 μL 50 milliunits/μL), 24-minute digest
    • 500 milliunits (1 μL 500 milliunits/μL), 24-minute digest
  • water to 20 μL

Incubate samples at 37[[:Category:{{{1}}}|{{{1}}}]] for specified time. Added 1 μL 10x TBE loading dye. Run on an 4-20% gradient TBE PA gel for 1 h at 120 V. Stained w/ SYBR Gold for 30 min. Imaged under EtBr filter.

  • expected ss sizes
    • 34 nt, 11 nt (digested ligand)
    • 29 nt, 8 nt (digested attachment DNA)
    • 45 nt (undigested ligand)
    • 37 nt (undigested attachment DNA)
Lane Contents
1 10 μL 25 bp+ ladder
2 10 μL 10 bp+ ladder
3 10 μL -enzyme, 12 min.
4 10 μL 50 mU, 12 min.
5 10 μL 500 mU, 12 min.
6 10 μL -enzyme, 24 min.
7 10 μL 50 mU, 24 min.
8 10 μL 500 mU, 24 min.
9 10 μL 10 bp+ ladder
10 10 μL 25 bp+ ladder

Made two new controls:

  • no enzyme, no oligo ligand; just attachment DNA + buffer + BSA + dye
  • no enzyme, no attachment DNA; just oligo ligand + buffer + BSA + dye

Another gel: 18% Tris-Gly PA gel, 1.5 h at 120 V. Stained w/ SYBR Gold. Imaged w/ EtBr filter.

Lane Contents
1 5 μL 25 bp+ ladder
2 5 μL 10 bp+ ladder
3 10 μL attachment DNA control mix
4 10 μL oligo ligand control mix
5 10 μL -enzyme, 12 min.
6 10 μL 50 mU, 12 min.
7 10 μL 500 mU, 12 min.
8 10 μL -enzyme, 24 min.
9 10 μL 50 mU, 24 min.
10 10 μL 500 mU, 24 min.
11 5 μL 10 bp+ ladder
12 5 μL 25 bp+ ladder

Microcon Fractionation Trials

  • Do the following with 6hb and c5.0 barrels:
  • reserve 40 uL (1 rxn) of folded nanostructure for gel
  • mix 200ul (5 rxns) of nanostructure + 200uL of dH2O
    • add 200uL of this dilution to Microcon sample reservoir
    • mark tube to be able to determine when 200uL is in it
  • add remaining 200uL of dilution to sample reservoir; cap
  • spin for 1 minute at 14,000 g (max spin speed recommended in Microcon manual)
    • remove from centrifuge and assess remaining liquid in sample reservoir
    • repeat till liquid remaining is 200uL
      • spinning down to 200uL from 400uL takes 3 min
  • remove the 200uL of flowthrough at the bottom of the vial for gel
    • repeat 4x (until there are 5 fractions total)
  • for the final 200uL, reverse the sample reservoir and place into a sample-collecting vial, as instructed by the Microcon manual
    • spin at 1g for 1min
  • run a gel for 1hr @ 110V with:
lane 0: 10uL 1x 1kb ladder
'''c5.0'''
lane 1: 40uL original reaction
lane 2: 40uL (out of 200uL) of fraction 1 of the flowthrough (should contain the bulk of the oligos)
lane 3: 40uL (out of 200uL) of fraction 2 of the flowthrough
lane 4: 40uL (out of 200uL) of fraction 3 of the flowthrough
lane 5: 40uL (out of 200uL) of fraction 4 of the flowthrough
lane 6: 40uL (out of 200uL) of fraction 5 of the flowthrough
lane 7: 40uL (out of 200uL) of final "top" product (should contain the nanostructures)
'''6hb'''
lane 8: 40uL original reaction
lane 9: 40uL (out of 200uL) of fraction 1 of the flowthrough (should contain the bulk of the oligos)
lane 10: 40uL (out of 200uL) of fraction 2 of the flowthrough
lane 11: 40uL (out of 200uL) of fraction 3 of the flowthrough
lane 12: 40uL (out of 200uL) of fraction 4 of the flowthrough
lane 13: 40uL (out of 200uL) of fraction 5 of the flowthrough
lane 14: 40uL (out of 200uL) of final "top" product (should contain the nanostructures)


Mg2+, 1:6x Titrations for Folding

  • aliquoted 20uL of each of the 6 rxns post-folding for gel
  • with the other 20uL of the 6 rxns, PEG precipitated:
Added:
   20uL 20% PEG
   10uL 2.5M NaCl
Iced for 15 min
Spun at 4 deg C for 10 min
Removed supernatant (50uL) to a separate tube
Reconstituted pellet in 20uL H2O
  • ran gel @ 100V for 1hr; loaded 20uL of each component with 2uL of loading dye:
lane 0: 4.5uL scaffold (44nM)
lane 1: 10nM Mg2+ final concentration, 1x oligos, PELLET
lane 2: 10nM Mg2+ final concentration, 1x oligos, SUPERNATANT
lane 3: 20nM Mg2+ final concentration, 1x oligos, PELLET
lane 4: 20nM Mg2+ final concentration, 1x oligos, SUPERNATANT
lane 5: 30nM Mg2+ final concentration, 1x oligos, PELLET
lane 6: 30nM Mg2+ final concentration, 1x oligos, SUPERNATANT
lane 7: 10nM Mg2+ final concentration, 6x oligos, PELLET
lane 8: 10nM Mg2+ final concentration, 6x oligos, SUPERNATANT
lane 9: 20nM Mg2+ final concentration, 6x oligos, PELLET
lane 10: 20nM Mg2+ final concentration, 6x oligos, SUPERNATANT
lane 11: 30nM Mg2+ final concentration, 6x oligos, PELLET
lane 12: 30nM Mg2+ final concentration, 6x oligos, SUPERNATANT
lane 13: 10uL 1x 1kb ladder
Retrieved from "https://openwetware.org/mediawiki/index.php?title=IGEM:Harvard/2006/DNA_nanostructures/Notebook/2006-8-7&oldid=57743"