IGEM:Harvard/2006/DNA nanostructures/Notebook/2006-8-7
From OpenWetWare
AscI digestion protocol proposal
adopted from Wednesday's proposal
Initial test, just oligos
Start by trying to digest ~25 ng DNA.
1 unit = enough enzyme to digest 1 μg DNA at 37[[:Category:{{{1}}}|{{{1}}}]] in 1 h in a total reaction volume of 50 μL [1]
- = enough enzyme to digest 5 μg DNA at 37[[:Category:{{{1}}}|{{{1}}}]] in 1 h in a total reaction volume of 10 μL
- = enough enzyme to digest 1 μg DNA at 37[[:Category:{{{1}}}|{{{1}}}]] in 12 min. in a total reaction volume of 10 μL
Mix together, adding enzyme last:
- 998 fmols (14.0 ng) ligand DNA (MW = 14,027 Da [2]) = 1 μL 1 μM
- 45 nt: TAAAGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
- 1 pmol (11.3 ng) attachment DNA c4.0.6.1.ob (MW = 11,259.3 Da) = 1 μL 1 μM
- 37 nt: AAGGCTCCGATCTATTTTTTTTCCGCGGGCGCGCCCC
- 2 μL 10x BSA
- 2 μL 10x NEBuffer 4 [3]
- 25 ng DNA should require 0.025 units (25 milliunits) for a 12-minute digest. Do the following trials:
- no enzyme, 12-minute digest
- no enzyme, 24-minute digest
- 50 milliunits (1 μL 50 milliunits/μL), 12-minute digest
- 500 milliunits (1 μL 500 milliunits/μL), 12-minute digest
- 50 milliunits (1 μL 50 milliunits/μL), 24-minute digest
- 500 milliunits (1 μL 500 milliunits/μL), 24-minute digest
- water to 20 μL
Incubate samples at 37[[:Category:{{{1}}}|{{{1}}}]] for specified time. Added 1 μL 10x TBE loading dye. Run on an 4-20% gradient TBE PA gel for 1 h at 120 V. Stained w/ SYBR Gold for 30 min. Imaged under EtBr filter.
- expected ss sizes
- 34 nt, 11 nt (digested ligand)
- 29 nt, 8 nt (digested attachment DNA)
- 45 nt (undigested ligand)
- 37 nt (undigested attachment DNA)
First gel analysis
Lane | Contents |
1 | 10 μL 25 bp+ ladder |
2 | 10 μL 10 bp+ ladder |
3 | 10 μL -enzyme, 12 min. |
4 | 10 μL 50 mU, 12 min. |
5 | 10 μL 500 mU, 12 min. |
6 | 10 μL -enzyme, 24 min. |
7 | 10 μL 50 mU, 24 min. |
8 | 10 μL 500 mU, 24 min. |
9 | 10 μL 10 bp+ ladder |
10 | 10 μL 25 bp+ ladder |
Results/discussion:
- gel shows poor resolution at low MW
- lack of one-DNA controls makes gel difficult to interpret
Second gel analysis
Made two new controls:
- no enzyme, no oligo ligand; just attachment DNA + buffer + BSA + dye
- no enzyme, no attachment DNA; just oligo ligand + buffer + BSA + dye
Another gel: 18% Tris-Gly PA gel, 1.5 h at 120 V. Stained w/ SYBR Gold. Imaged w/ EtBr filter.
Lane | Contents |
1 | 5 μL 25 bp+ ladder |
2 | 5 μL 10 bp+ ladder |
3 | 10 μL attachment DNA control mix |
4 | 10 μL oligo ligand control mix |
5 | 10 μL -enzyme, 12 min. |
6 | 10 μL 50 mU, 12 min. |
7 | 10 μL 500 mU, 12 min. |
8 | 10 μL -enzyme, 24 min. |
9 | 10 μL 50 mU, 24 min. |
10 | 10 μL 500 mU, 24 min. |
11 | 5 μL 10 bp+ ladder |
12 | 5 μL 25 bp+ ladder |
Results/discussion:
- lane 3 shows ss attachment DNA (37 nt) at about 85 bp
- lane 4 shows oligo ligand DNA (45 nt) at about 28 bp
- this is perplexing as to why shorter DNA is running slower -- maybe mixed them up when loading lanes 3 and 4?
- lanes 5, 8 shows ds construct slightly gel shifted from lane 3
- lanes 6, 9 show partial digestion from partial disappearance of band in lanes 5 and 8, as well as appearance of digested DNA (29 nt) at about 20 bp
- lanes 7, 10 show more complete digestion from near complete disappearance of band in lanes 5 and 8, as well as further appearance of digested DNA
- lanes 10 shows higher concentration of DNA at dye front, which likely contains extra smaller digest products
- increased concentration of enzyme appears to be more important than digest duration, although increased duration (lane 7 vs. lane 10) appears to help as well
Microcon Fractionation Trials
- Do the following with 6hb and c5.0 barrels:
- reserve 40 uL (1 rxn) of folded nanostructure for gel
- mix 200ul (5 rxns) of nanostructure + 200uL of dH2O
- add 200uL of this dilution to Microcon sample reservoir
- mark tube to be able to determine when 200uL is in it
- add remaining 200uL of dilution to sample reservoir; cap
- spin for 1 minute at 14,000 g (max spin speed recommended in Microcon manual)
- remove from centrifuge and assess remaining liquid in sample reservoir
- repeat till liquid remaining is 200uL
- spinning down to 200uL from 400uL takes 3 min
- remove the 200uL of flowthrough at the bottom of the vial for gel
- repeat 4x (until there are 5 fractions total)
- for the final 200uL, reverse the sample reservoir and place into a sample-collecting vial, as instructed by the Microcon manual
- spin at 1g for 1min
- run a gel for 1hr @ 110V with:
lane 0: 10uL 1x 1kb ladder '''c5.0''' lane 1: 40uL original reaction lane 2: 40uL (out of 200uL) of fraction 1 of the flowthrough (should contain the bulk of the oligos) lane 3: 40uL (out of 200uL) of fraction 2 of the flowthrough lane 4: 40uL (out of 200uL) of fraction 3 of the flowthrough lane 5: 40uL (out of 200uL) of fraction 4 of the flowthrough lane 6: 40uL (out of 200uL) of fraction 5 of the flowthrough lane 7: 40uL (out of 200uL) of final "top" product (should contain the nanostructures) '''6hb''' lane 8: 40uL original reaction lane 9: 40uL (out of 200uL) of fraction 1 of the flowthrough (should contain the bulk of the oligos) lane 10: 40uL (out of 200uL) of fraction 2 of the flowthrough lane 11: 40uL (out of 200uL) of fraction 3 of the flowthrough lane 12: 40uL (out of 200uL) of fraction 4 of the flowthrough lane 13: 40uL (out of 200uL) of fraction 5 of the flowthrough lane 14: 40uL (out of 200uL) of final "top" product (should contain the nanostructures)
Mg2+, 1:6x Titrations for Folding
- aliquoted 20uL of each of the 6 rxns post-folding for gel
- with the other 20uL of the 6 rxns, PEG precipitated:
Added: 20uL 20% PEG 10uL 2.5M NaCl Iced for 15 min Spun at 4 deg C for 10 min Removed supernatant (50uL) to a separate tube Reconstituted pellet in 20uL H2O
- ran gel @ 100V for 1hr; loaded 20uL of each component with 2uL of loading dye:
lane 0: 4.5uL scaffold (44nM) lane 1: 10nM Mg2+ final concentration, 1x oligos, PELLET lane 2: 10nM Mg2+ final concentration, 1x oligos, SUPERNATANT lane 3: 20nM Mg2+ final concentration, 1x oligos, PELLET lane 4: 20nM Mg2+ final concentration, 1x oligos, SUPERNATANT lane 5: 30nM Mg2+ final concentration, 1x oligos, PELLET lane 6: 30nM Mg2+ final concentration, 1x oligos, SUPERNATANT lane 7: 10nM Mg2+ final concentration, 6x oligos, PELLET lane 8: 10nM Mg2+ final concentration, 6x oligos, SUPERNATANT lane 9: 20nM Mg2+ final concentration, 6x oligos, PELLET lane 10: 20nM Mg2+ final concentration, 6x oligos, SUPERNATANT lane 11: 30nM Mg2+ final concentration, 6x oligos, PELLET lane 12: 30nM Mg2+ final concentration, 6x oligos, SUPERNATANT lane 13: 10uL 1x 1kb ladder