IGEM:Harvard/2007/Laboratory Notebooks/Two Component System: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
m (New page: 6/27/07 - Ordered oligos to create a FecA promoter BioBrick that can be used to recombine with GFP to create a reporter system. The oligos ordered were as follows: Construct 1 5’- GTTTC...) |
mNo edit summary |
||
Line 6: | Line 6: | ||
6/27/07 - | 6/27/07 - Grew bacteria (FecA, FecI, FecR) in liquid culture to prepare for sequencing tomorrow, inoculation in 2 ml LB and 2 ul amp 50mg/ml 1000x. | ||
[edit] | [edit] | ||
6/28/07 - Miniprepped to prepare for sequencing, nanodropped to confirm presence of DNA, sequencing rxns: | |||
SV001 - FecA plus VF2 | |||
SV002 - FecA plus VR | |||
SV003 - FecR plus VF2 | |||
SV004 - FecR plus VR | |||
SV005 - FecI plus VF2 | |||
SV006 - FecI plus VR |
Revision as of 09:08, 28 June 2007
6/27/07 - Ordered oligos to create a FecA promoter BioBrick that can be used to recombine with GFP to create a reporter system.
The oligos ordered were as follows: Construct 1 5’- GTTTCTTCGAATTCGCGGCCGCTTCTAGAGatttcaccactgtaaggaaaataattcttatttc – 3’
Construct 2 5’- GTTTCTTCCTGCAGCGGCCGCTACTAGTAAGGGTAAAAAGGACAATCGAAATAAGAATTATTT – 3’
6/27/07 - Grew bacteria (FecA, FecI, FecR) in liquid culture to prepare for sequencing tomorrow, inoculation in 2 ml LB and 2 ul amp 50mg/ml 1000x.
[edit]
6/28/07 - Miniprepped to prepare for sequencing, nanodropped to confirm presence of DNA, sequencing rxns:
SV001 - FecA plus VF2 SV002 - FecA plus VR SV003 - FecR plus VF2 SV004 - FecR plus VR SV005 - FecI plus VF2 SV006 - FecI plus VR