IGEM:Harvard/2007/Laboratory Notebooks/Two Component System

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
m
m
Line 36: Line 36:
-
Insert site directed mutagenesis stuff here
+
'''6/28/07'''
 +
Miniprep done.  Sent for sequencing.
 +
 
 +
Emails sent to:
 +
 
 +
Duke:<br>
 +
Dr. Homme W. Hellinga<br>
 +
Dr. Loren L. Looger<br>
 +
 
 +
Penn State:<br>
 +
Dr. Hossein Fazelinia<br>
 +
Dr. Costas D. Maranas<br>
 +
Dr. Gregory L. Moore<br>
 +
 
 +
 
 +
PCR extension of constructs 1 and 2<br>
 +
-3 cycles of PCR<br>
 +
-diluted first to 500 uM, then to 20 uM<br>
 +
-15 uL of water, 10 uL of DNA, 25 uL of PCR master mix for each.<br>
 +
-two redundant reactions, R1 and R2<br>
 +
-R2 may be wrong becuase of volume errors<br>
 +
 
 +
 
 +
'''6/29/07'''
 +
Reply from George Khoury of Penn State lab under Maranas.  He has agreed to assist us with computational design.
 +
 
 +
 
 +
'''Week of 7/1/07'''<br>
 +
-Continued contact with George Khoury, including a cell phone conversation w/ Ellenor on 7/3/07 and an in-person talk w/ Shaunak to be scheduled for 7/7/07.  We've decided on lead (Pb) a small molecule ligand and Muc1 as a macromolecule (glycoprotein) ligand for FecA.  Muc1 is a cancer antigen,  a glycoprotein overexpressed on tumor cells.  They are underglycolysated on cancerous cells.<br>
 +
- 7/5/07: Directed Mutagenesis of FecA and FecR to remove Pst1 restriction site.<br>
 +
- 7/6/07: Transformation of FecA' and FecR' (pending recovery of previous day's PCR product)<br>
 +
Also, Shaunak and George's meeting went well.  Notes are under "Brainstorming"
 +
 
 +
 

Revision as of 17:22, 9 July 2007

6/27/07 - Ordered oligos to create a FecA promoter BioBrick that can be used to recombine with GFP to create a reporter system.

The oligos ordered were as follows:

Construct 1 5’- GTTTCTTCGAATTCGCGGCCGCTTCTAGAGatttcaccactgtaaggaaaataattcttatttc – 3’

Construct 2 5’- GTTTCTTCCTGCAGCGGCCGCTACTAGTAAGGGTAAAAAGGACAATCGAAATAAGAATTATTT – 3’


6/27/07 - Grew bacteria (FecA, FecI, FecR) in liquid culture to prepare for sequencing tomorrow, inoculation in 2 ml LB and 2 ul amp 50mg/ml 1000x. [edit]


6/28/07 - Miniprepped to prepare for sequencing, nanodropped to confirm presence of DNA, sequencing rxns:

SV001 - FecA plus VF2

SV002 - FecA plus VR

SV003 - FecR plus VF2

SV004 - FecR plus VR

SV005 - FecI plus VF2

SV006 - FecI plus VR


PCR extension of constructs 1 and 2
-3 cycles of PCR
-diluted first to 500 uM, then to 20 uM
-15 uL of water, 10 uL of DNA, 25 uL of PCR master mix for each.
-two redundant reactions, R1 and R2
-R2 may be wrong becuase of volume errors


6/28/07 Miniprep done. Sent for sequencing.

Emails sent to:

Duke:
Dr. Homme W. Hellinga
Dr. Loren L. Looger

Penn State:
Dr. Hossein Fazelinia
Dr. Costas D. Maranas
Dr. Gregory L. Moore


PCR extension of constructs 1 and 2
-3 cycles of PCR
-diluted first to 500 uM, then to 20 uM
-15 uL of water, 10 uL of DNA, 25 uL of PCR master mix for each.
-two redundant reactions, R1 and R2
-R2 may be wrong becuase of volume errors


6/29/07 Reply from George Khoury of Penn State lab under Maranas. He has agreed to assist us with computational design.


Week of 7/1/07
-Continued contact with George Khoury, including a cell phone conversation w/ Ellenor on 7/3/07 and an in-person talk w/ Shaunak to be scheduled for 7/7/07. We've decided on lead (Pb) a small molecule ligand and Muc1 as a macromolecule (glycoprotein) ligand for FecA. Muc1 is a cancer antigen, a glycoprotein overexpressed on tumor cells. They are underglycolysated on cancerous cells.
- 7/5/07: Directed Mutagenesis of FecA and FecR to remove Pst1 restriction site.
- 7/6/07: Transformation of FecA' and FecR' (pending recovery of previous day's PCR product)
Also, Shaunak and George's meeting went well. Notes are under "Brainstorming"



7/9/07
-miniprep of site directed mutagenesis using QiaGen Miniprep kit

-purification of construct C1+C2 extension rxn R1 using QiaGen PCR purification protocol--labeled product 'FecA promoter biobrick'

-received E Coli AA93, plasmid pLCIRA, pGFPA' from Germany, waiting on instructions from Dr. Braun on how to plate them.

-grow E0240 in liquid culture

Personal tools