IGEM:Harvard/2007/Laboratory Notebooks/Two Component System

6/27/07 - Ordered oligos to create a FecA promoter BioBrick that can be used to recombine with GFP to create a reporter system.

The oligos ordered were as follows:

Construct 1 5’- GTTTCTTCGAATTCGCGGCCGCTTCTAGAGatttcaccactgtaaggaaaataattcttatttc – 3’

Construct 2 5’- GTTTCTTCCTGCAGCGGCCGCTACTAGTAAGGGTAAAAAGGACAATCGAAATAAGAATTATTT – 3’

6/27/07 - Grew bacteria (FecA, FecI, FecR) in liquid culture to prepare for sequencing tomorrow, inoculation in 2 ml LB and 2 ul amp 50mg/ml 1000x. [edit]

6/28/07 - Miniprepped to prepare for sequencing, nanodropped to confirm presence of DNA, sequencing rxns:

SV001 - FecA plus VF2

SV002 - FecA plus VR

SV003 - FecR plus VF2

SV004 - FecR plus VR

SV005 - FecI plus VF2

SV006 - FecI plus VR

PCR extension of constructs 1 and 2
-3 cycles of PCR
-diluted first to 500 uM, then to 20 uM
-15 uL of water, 10 uL of DNA, 25 uL of PCR master mix for each.
-two redundant reactions, R1 and R2
-R2 may be wrong becuase of volume errors

6/28/07 Miniprep done. Sent for sequencing.

Emails sent to:

Duke:
Dr. Homme W. Hellinga
Dr. Loren L. Looger

Penn State:
Dr. Hossein Fazelinia
Dr. Costas D. Maranas
Dr. Gregory L. Moore

PCR extension of constructs 1 and 2
-3 cycles of PCR
-diluted first to 500 uM, then to 20 uM
-15 uL of water, 10 uL of DNA, 25 uL of PCR master mix for each.
-two redundant reactions, R1 and R2
-R2 may be wrong becuase of volume errors

6/29/07 Reply from George Khoury of Penn State lab under Maranas. He has agreed to assist us with computational design.

Week of 7/1/07
-Continued contact with George Khoury, including a cell phone conversation w/ Ellenor on 7/3/07 and an in-person talk w/ Shaunak to be scheduled for 7/7/07. We've decided on lead (Pb) a small molecule ligand and Muc1 as a macromolecule (glycoprotein) ligand for FecA. Muc1 is a cancer antigen, a glycoprotein overexpressed on tumor cells. They are underglycolysated on cancerous cells.
- 7/5/07: Directed Mutagenesis of FecA and FecR to remove Pst1 restriction site.
- 7/6/07: Transformation of FecA' and FecR' (pending recovery of previous day's PCR product)
Also, Shaunak and George's meeting went well. Notes are under "Brainstorming"

7/9/07
-miniprep of site directed mutagenesis using QiaGen Miniprep kit

-purification of construct C1+C2 extension rxn R1 using QiaGen PCR purification protocol--labeled product 'FecA promoter biobrick'

-received E Coli AA93, plasmid pLCIRA, pGFPA' from Germany, waiting on instructions from Dr. Braun on how to plate them.

-grow E0240 in liquid culture