IGEM:Harvard/2007/Laboratory Notebooks/Two Component System

6/27/07 - Ordered oligos to create a FecA promoter BioBrick that can be used to recombine with GFP to create a reporter system.

The oligos ordered were as follows:

Construct 1 5’- GTTTCTTCGAATTCGCGGCCGCTTCTAGAGatttcaccactgtaaggaaaataattcttatttc – 3’

Construct 2 5’- GTTTCTTCCTGCAGCGGCCGCTACTAGTAAGGGTAAAAAGGACAATCGAAATAAGAATTATTT – 3’

6/27/07 - Grew bacteria (FecA, FecI, FecR) in liquid culture to prepare for sequencing tomorrow, inoculation in 2 ml LB and 2 ul amp 50mg/ml 1000x. [edit]

6/28/07 - Miniprepped to prepare for sequencing, nanodropped to confirm presence of DNA, sequencing rxns:

SV001 - FecA plus VF2

SV002 - FecA plus VR

SV003 - FecR plus VF2

SV004 - FecR plus VR

SV005 - FecI plus VF2

SV006 - FecI plus VR

Insert site directed mutagenesis stuff here

7/9/07
-miniprep of site directed mutagenesis using QiaGen Miniprep kit

-purification of construct C1+C2 extension rxn R1 using QiaGen PCR purification protocol--labeled product 'FecA promoter biobrick'

-received E Coli AA93, plasmid pLCIRA, pGFPA' from Germany, waiting on instructions from Dr. Braun on how to plate them.

-grow E0240 in liquid culture