IGEM:Harvard/2007/Laboratory Notebooks/Two Component System
6/27/07 - Ordered oligos to create a FecA promoter BioBrick that can be used to recombine with GFP to create a reporter system.
The oligos ordered were as follows:
Construct 1 5’- GTTTCTTCGAATTCGCGGCCGCTTCTAGAGatttcaccactgtaaggaaaataattcttatttc – 3’
Construct 2 5’- GTTTCTTCCTGCAGCGGCCGCTACTAGTAAGGGTAAAAAGGACAATCGAAATAAGAATTATTT – 3’
6/27/07 - Grew bacteria (FecA, FecI, FecR) in liquid culture to prepare for sequencing tomorrow, inoculation in 2 ml LB and 2 ul amp 50mg/ml 1000x.
[edit]
6/28/07 - Miniprepped to prepare for sequencing, nanodropped to confirm presence of DNA, sequencing rxns:
SV001 - FecA plus VF2
SV002 - FecA plus VR
SV003 - FecR plus VF2
SV004 - FecR plus VR
SV005 - FecI plus VF2
SV006 - FecI plus VR
PCR extension of constructs 1 and 2
-3 cycles of PCR
-diluted first to 500 uM, then to 20 uM
-15 uL of water, 10 uL of DNA, 25 uL of PCR master mix for each.
-two redundant reactions, R1 and R2
-R2 may be wrong becuase of volume errors
6/28/07
Miniprep done. Sent for sequencing.
Emails sent to:
Duke:
Dr. Homme W. Hellinga
Dr. Loren L. Looger
Penn State:
Dr. Hossein Fazelinia
Dr. Costas D. Maranas
Dr. Gregory L. Moore
PCR extension of constructs 1 and 2
-3 cycles of PCR
-diluted first to 500 uM, then to 20 uM
-15 uL of water, 10 uL of DNA, 25 uL of PCR master mix for each.
-two redundant reactions, R1 and R2
-R2 may be wrong becuase of volume errors
6/29/07
Reply from George Khoury of Penn State lab under Maranas. He has agreed to assist us with computational design.
Week of 7/1/07
-Continued contact with George Khoury, including a cell phone conversation w/ Ellenor on 7/3/07 and an in-person talk w/ Shaunak to be scheduled for 7/7/07. We've decided on lead (Pb) a small molecule ligand and Muc1 as a macromolecule (glycoprotein) ligand for FecA. Muc1 is a cancer antigen, a glycoprotein overexpressed on tumor cells. They are underglycolysated on cancerous cells.
- 7/5/07: Directed Mutagenesis of FecA and FecR to remove Pst1 restriction site.
- 7/6/07: Transformation of FecA' and FecR' (pending recovery of previous day's PCR product)
Also, Shaunak and George's meeting went well. Notes are under "Brainstorming"
7/9/07
-miniprep of site directed mutagenesis using QiaGen Miniprep kit
-purification of construct C1+C2 extension rxn R1 using QiaGen PCR purification protocol--labeled product 'FecA promoter biobrick'
-received E Coli AA93, plasmid pLCIRA, pGFPA' from Germany, waiting on instructions from Dr. Braun on how to plate them.
-grow E0240 in liquid culture
Week of 7/7/07
-7/7/07: Transformation of FecA' and FecR' into cells, completing the Quickchange Kit protocol.
-7/8/07: Growth of liquid cultures from mutagenesis.
-7/9/07: Plates streaked with cells containing FecA' and FecR' from liquid cultures. Miniprep performed on liquid cultures. Digestion with Pst1 performed on a portion of miniprepped plasmids and on plasmids containing FecA and FecR. An Egel was run to determine whether the mutagenesis was successful. FecA' (A1B) and FecR' (R5B) were placed into liquid culture from previously streaked plate. FecI was grown in liquid culture. The mutagenesis looks successful, but it's late and I'm not quite sure - Alex.