IGEM:Harvard/2007/Sequences

From OpenWetWare

< IGEM:Harvard | 2007(Difference between revisions)
Jump to: navigation, search
m
Current revision (11:50, 24 August 2007) (view source)
 
(9 intermediate revisions not shown.)
Line 212: Line 212:
5’ caaa|Nde1| biobrick| 25 bases of OmpA 3’<br>
5’ caaa|Nde1| biobrick| 25 bases of OmpA 3’<br>
5’caaaacatatgGAATTCGCGGCCGCtTCTAGAatgaaagctactaaactggtactgg 3’<br><br>
5’caaaacatatgGAATTCGCGGCCGCtTCTAGAatgaaagctactaaactggtactgg 3’<br><br>
-
'''NOTE: Mike will bring in the non-biobrick version'''
+
'''NOTE: Non-biobrick version to be used'''
---------
---------
<br>
<br>
Line 231: Line 231:
5’ caaa|Xho1|stop|random library| last 25 bases OmpA ‘3 (reverse complements)<br>
5’ caaa|Xho1|stop|random library| last 25 bases OmpA ‘3 (reverse complements)<br>
5’ caaaCTCGAGttabnnbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnaagcttctgcagttatcagctagcg 3’
5’ caaaCTCGAGttabnnbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnaagcttctgcagttatcagctagcg 3’
 +
---------
 +
 +
---------
 +
<br>
 +
'''pET with AIDA-1 signal, insertion site, and AIDA-1''' (update 8/24/07)<br>
 +
(pet29b+ vector) (Nde1) - AIDA signal - insertion site with Nhe1 and Sbf1 (compatible with Xba and Pst of normal biobricks) AIDA1 sequence -stop codon - "Not1" (pet29b+vector)
 +
<br>
 +
(aaggagatata)''CAT '''ATG'' att aaa tta aaa ttt ggt  gtt  ttt  ttt  aca gtt tta cta  tct  tca  gca tat gcc tac gca cat gga aca cct ''GCTAGC''  gca gg''C CTGCAG G''ga ctt aatcctacaa aagaaagtgc aggtaatact cttaccgtgt caaattatac tgggacaccg ggaagtgtta tttctcttgg tggtgtgctt gaaggagata attcacttac ggaccgtctg gtggtgaaag gtaatacctc tggtcaaagt gacatcgttt atgtcaatga agatggcagt ggtggtcaga cgagagatgg tattaatatt atttctgtag agggaaattc tgatgcagaa ttctctctga agaaccgcgt agttgccgga gcttatgatt acacactgca gaaaggaaac gagagtggga cagataataa gggatggtat ttaaccagtc atcttcccac atctgatacc cggcaataca gaccggagaa cggaagttat gctaccaata tggcactggc taactcactg ttcctcatgg atttgaatga gcgtaagcaa ttcagggcca tgagtgataa tacacagcct gagtctgcat ccgtgtggat gaagatcact ggaggaagaa gctctggtaa gcttaatgac gggcaaaata aaacaacaac caatcagttt atcaatcagc tcggggggga tatttataaa ttccatgctg aacaactggg tgattttacc ttagggatta tgggaggata cgcgaatgca aaaggtaaaa cgataaatta cacgagcaac aaagctgcca gaaacacact ggatggttat tctgtcgggg tatacggtac gtggtatcag aatggggaaa atgcaacagg gctctttgct gaaacttgga tgcaatataa ctggtttaat gcatcagtga aaggtgacgg actggaagaa gaaaaatata atctgaatgg tttaaccgct tctgcaggtg ggggatataa cctgaatgtg cacacatgga catcacctga aggaataaca ggtgaattct ggttgcagcc tcatttgcag gctgtctgga tgggggttac accggataca catcaggagg ataacggaac ggtggtgcag ggagcaggga aaaataatat tcagacaaaa gcaggtattc gtgcatcctg gaaggtgaaa agcaccctgg ataaggatac cgggcgggag ttccgtccgt atatagaggc aaactggatc cataacactc atgaatttgg tgttaaaatg agtgatgaca gccagttgtt gtcaggtagc cgaaatcagg gagagataaa gacaggtatt gaaggggtga ttactcaaaa cttgtcagtg aatggcggag tcgcatatca ggcaggaggt cacgggagca atgccatctc cggagcactg gggataaaat acagcttctg a''' ''GCGGCCGC'' (actcgagcaccacc)
 +
---------
 +
---------
 +
<br>
 +
'''pET with AIDA-1 signal, his tag, and AIDA-1''' (update 8/24/07)<br>
 +
(pet29b+ vector) (Nde1) - AIDA signal - insertion site with his tag - AIDA1 sequence - stop codon - "Not1" (pet29b+vector)
 +
<br>
 +
(aaggagatata)''CAT '''ATG'' att aaa tta aaa ttt ggt  gtt  ttt  ttt  aca gtt tta cta  tct  tca  gca tat gcc tac gca cat gga aca cct GCTAGt ''cat cac cac cat cat cac cat cac cac cac'' gctagc gca ggt CTGCAG Gga ctt aatcctacaa aagaaagtgc aggtaatact cttaccgtgt caaattatac tgggacaccg ggaagtgtta tttctcttgg tggtgtgctt gaaggagata attcacttac ggaccgtctg gtggtgaaag gtaatacctc tggtcaaagt gacatcgttt atgtcaatga agatggcagt ggtggtcaga cgagagatgg tattaatatt atttctgtag agggaaattc tgatgcagaa ttctctctga agaaccgcgt agttgccgga gcttatgatt acacactgca gaaaggaaac gagagtggga cagataataa gggatggtat ttaaccagtc atcttcccac atctgatacc cggcaataca gaccggagaa cggaagttat gctaccaata tggcactggc taactcactg ttcctcatgg atttgaatga gcgtaagcaa ttcagggcca tgagtgataa tacacagcct gagtctgcat ccgtgtggat gaagatcact ggaggaagaa gctctggtaa gcttaatgac gggcaaaata aaacaacaac caatcagttt atcaatcagc tcggggggga tatttataaa ttccatgctg aacaactggg tgattttacc ttagggatta tgggaggata cgcgaatgca aaaggtaaaa cgataaatta cacgagcaac aaagctgcca gaaacacact ggatggttat tctgtcgggg tatacggtac gtggtatcag aatggggaaa atgcaacagg gctctttgct gaaacttgga tgcaatataa ctggtttaat gcatcagtga aaggtgacgg actggaagaa gaaaaatata atctgaatgg tttaaccgct tctgcaggtg ggggatataa cctgaatgtg cacacatgga catcacctga aggaataaca ggtgaattct ggttgcagcc tcatttgcag gctgtctgga tgggggttac accggataca catcaggagg ataacggaac ggtggtgcag ggagcaggga aaaataatat tcagacaaaa gcaggtattc gtgcatcctg gaaggtgaaa agcaccctgg ataaggatac cgggcgggag ttccgtccgt atatagaggc aaactggatc cataacactc atgaatttgg tgttaaaatg agtgatgaca gccagttgtt gtcaggtagc cgaaatcagg gagagataaa gacaggtatt gaaggggtga ttactcaaaa cttgtcagtg aatggcggag tcgcatatca ggcaggaggt cacgggagca atgccatctc cggagcactg gggataaaat acagcttctg a''' ''GCGGCCGC'' (actcgagcaccacc)
 +
---------
 +
 +
 +
---------
 +
<br>
 +
'''pET with AIDA-1 signal, strep2 tag, and AIDA-1''' (update 8/24/07)<br>
 +
(pet29b+ vector) (Nde1) - AIDA signal - insertion site with strep2 tag - AIDA1 sequence - stop codon - "Not1" (pet29b+vector)
 +
<br>
 +
(aaggagatata)''CAT '''ATG'' att aaa tta aaa ttt ggt  gtt  ttt  ttt  aca gtt tta cta  tct  tca  gca tat gcc tac gca cat gga aca cct GCTAGt ''tgg agc cac ccg cag ttc gaa aag'' gctagc gca ggt CTGCAG Gga ctt aatcctacaa aagaaagtgc aggtaatact cttaccgtgt caaattatac tgggacaccg ggaagtgtta tttctcttgg tggtgtgctt gaaggagata attcacttac ggaccgtctg gtggtgaaag gtaatacctc tggtcaaagt gacatcgttt atgtcaatga agatggcagt ggtggtcaga cgagagatgg tattaatatt atttctgtag agggaaattc tgatgcagaa ttctctctga agaaccgcgt agttgccgga gcttatgatt acacactgca gaaaggaaac gagagtggga cagataataa gggatggtat ttaaccagtc atcttcccac atctgatacc cggcaataca gaccggagaa cggaagttat gctaccaata tggcactggc taactcactg ttcctcatgg atttgaatga gcgtaagcaa ttcagggcca tgagtgataa tacacagcct gagtctgcat ccgtgtggat gaagatcact ggaggaagaa gctctggtaa gcttaatgac gggcaaaata aaacaacaac caatcagttt atcaatcagc tcggggggga tatttataaa ttccatgctg aacaactggg tgattttacc ttagggatta tgggaggata cgcgaatgca aaaggtaaaa cgataaatta cacgagcaac aaagctgcca gaaacacact ggatggttat tctgtcgggg tatacggtac gtggtatcag aatggggaaa atgcaacagg gctctttgct gaaacttgga tgcaatataa ctggtttaat gcatcagtga aaggtgacgg actggaagaa gaaaaatata atctgaatgg tttaaccgct tctgcaggtg ggggatataa cctgaatgtg cacacatgga catcacctga aggaataaca ggtgaattct ggttgcagcc tcatttgcag gctgtctgga tgggggttac accggataca catcaggagg ataacggaac ggtggtgcag ggagcaggga aaaataatat tcagacaaaa gcaggtattc gtgcatcctg gaaggtgaaa agcaccctgg ataaggatac cgggcgggag ttccgtccgt atatagaggc aaactggatc cataacactc atgaatttgg tgttaaaatg agtgatgaca gccagttgtt gtcaggtagc cgaaatcagg gagagataaa gacaggtatt gaaggggtga ttactcaaaa cttgtcagtg aatggcggag tcgcatatca ggcaggaggt cacgggagca atgccatctc cggagcactg gggataaaat acagcttctg a''' ''GCGGCCGC'' (actcgagcaccacc)
 +
---------
 +
---------
 +
<br>
 +
'''Biobricked OmpA with an NheI site at beginning of loop one''' <br>
 +
gggcgaattgggtaccgaattcgcggccgcttctagaatgaaaaagacagctatcgcgattgcagtggcactggctggtttcgctaccgtagcgcaggccgctccgaaagataacacctggtacactggtgctaaactgggctggtcccagtaccatgacactggtttcatcgctagcaatggcccgacccatgaaaaccaactgggcgctggtgcttttggtggttaccaggttaacccgtatgttggctttgaaatgggttacgactggttaggtcgtatgccgtacaaaggcagcgttgaaaacggtgcatacaaagctcagggcgttcaactgaccgctaaactgggttacccaatcactgacgacctggacatctacactcgtctgggtggcatggtatggcgtgcagacactaaatccaacgtttatggtaaaaaccacgacaccggcgtttctccggtcttcgctggcggtgttgagtacgcgatcactcctgaaatcgctacccgtctggaataccagtggaccaacaacatcggtgacgcacacaccatcggcactcgtccggacaacggcatgctgagcctgggtgtttcctaccgtttcggtcagggcgaagcagctccagtagttgctccggctccagctccggcaccggaagtacagaccaagcacttcactctgaagtctgacgttctgttcaacttcaacaaagcaaccctgaaaccggaaggtcaggctgctctggatcagctgtacagccagctgagcaacctggatccgaaagacggttccgtagttgttctgggttacaccgaccgcatcggttctgacgcttacaaccagggtctgtccgagcgccgtgctcagtctgttgttgattacctgatctccaaaggtatcccggcagacaagatctccgcacgtggtatgggcgaatccaacccggttactggcaacacctgtgacaacgtgaaacagcgtgctgcactgatcgactgcctggctccggatcgtcgcgtagagatcgaagttaaaggtatcaaagacgttgtaactcagccgcaggctactagttaaagcggccgctgcagagctccagcttttgttccc3'
---------
---------

Current revision

OmpA sequence E. coli |EG10669|OmpA: 346 aa - Outer membrane protein 3a (II*;G;d) structural gene

  1 - MKKTAIAIAV ALAGFATVAQ AAPKDNTWYT GAKLGWSQYH DTGFINNNGP THENQLGAGA
 61 - FGGYQVNPYV GFEMGYDWLG RMPYKGSVEN GAYKAQGVQL TAKLGYPITD DLDIYTRLGG
121 - MVWRADTKSN VYGKNHDTGV SPVFAGGVEY AITPEIATRL EYQWTNNIGD AHTIGTRPDN
181 - GMLSLGVSYR FGQGEAAPVV APAPAPAPEV QTKHFTLKSD VLFNFNKATL KPEGQAALDQ
241 - LYSQLSNLDP KDGSVVVLGY TDRIGSDAYN QGLSERRAQS VVDYLISKGI PADKISARGM
301 - GESNPVTGNT CDNVKQRAAL IDCLAPDRRV EIEVKGIKDV VTQPQA

E. coli |EG10669|ompA: 1041 bp - Outer membrane protein 3a (II*;G;d) structural gene

   1 - atg aaa aag aca gct atc gcg att gca gtg
  31 - gca ctg gct ggt ttc gct acc gta gcg cag
  61 - gcc gct ccg aaa gat aac acc tgg tac act
  91 - ggt gct aaa ctg ggc tgg tcc cag tac cat
 121 - gac act ggt ttc atc aac aac aat ggc ccg
 151 - acc cat gaa aac caa ctg ggc gct ggt gct
 181 - ttt ggt ggt tac cag gtt aac ccg tat gtt
 211 - ggc ttt gaa atg ggt tac gac tgg tta ggt
 241 - cgt atg ccg tac aaa ggc agc gtt gaa aac
 271 - ggt gca tac aaa gct cag ggc gtt caa ctg
 301 - acc gct aaa ctg ggt tac cca atc act gac
 331 - gac ctg gac atc tac act cgt ctg ggt ggc
 361 - atg gta tgg cgt gca gac act aaa tcc aac
 391 - gtt tat ggt aaa aac cac gac acc ggc gtt
 421 - tct ccg gtc ttc gct ggc ggt gtt gag tac
 451 - gcg atc act cct gaa atc gct acc cgt ctg
 481 - gaa tac cag tgg acc aac aac atc ggt gac
 511 - gca cac acc atc ggc act cgt ccg gac aac
 541 - ggc atg ctg agc ctg ggt gtt tcc tac cgt
 571 - ttc ggt cag ggc gaa gca gct cca gta gtt
 601 - gct ccg gct cca gct ccg gca ccg gaa gta
 631 - cag acc aag cac ttc act ctg aag tct gac
 661 - gtt ctg ttc aac ttc aac aaa gca acc ctg
 691 - aaa ccg gaa ggt cag gct gct ctg gat cag
 721 - ctg tac agc cag ctg agc aac ctg gat ccg
 751 - aaa gac ggt tcc gta gtt gtt ctg ggt tac
 781 - acc gac cgc atc ggt tct gac gct tac aac
 811 - cag ggt ctg tcc gag cgc cgt gct cag tct
 841 - gtt gtt gat tac ctg atc tcc aaa ggt atc
 871 - ccg gca gac aag atc tcc gca cgt ggt atg
 901 - ggc gaa tcc aac ccg gtt act ggc aac acc
 931 - tgt gac aac gtg aaa cag cgt gct gca ctg
 961 - atc gac tgc ctg gct ccg gat cgt cgc gta
 991 - gag atc gaa gtt aaa ggt atc aaa gac gtt
1021 - gta act cag ccg cag gct taa

E. coli |EG10544|Lpp: 78 aa - Murein lipoprotein structural gene

 1 - MKATKLVLGA VILGSTLLAG CSSNAKIDQL SSDVQTLNAK VDQLSNDVNA MRSDVQAAKD
61 - DAARANQRLD NMATKYRK

E. coli |EG10544|lpp: 237 bp - Murein lipoprotein structural gene

  1 - atg aaa gct act aaa ctg gta ctg ggc gcg
 31 - gta atc ctg ggt tct act ctg ctg gca ggt
 61 - tgc tcc agc aac gct aaa atc gat cag ctg
 91 - tct tct gac gtt cag act ctg aac gct aaa
121 - gtt gac cag ctg agc aac gac gtg aac gca
151 - atg cgt tcc gac gtt cag gct gct aaa gat
181 - gac gca gct cgt gct aac cag cgt ctg gac
211 - aac atg gct act aaa tac cgc aag taa 

MNS20 (Omp-10mer aa random library coding) (BioMod Foundation) (with stop)
5’ gcggctg ggag actagt nnb nnb nnb nnb nnb nnb nnb nnb nnb nnb gctagc tgataa ctgcag cccg 3’



MNS32 (OmpA rand lib 15mer) (BioMod Foundation)
5' gcggctg ggag actagt nnb nnb nnb nnb nnb nnb nnb nnb nnb nnb nnb nnb nnb nnb nnb gctagc tgataa ctgcag cccg 3'



MNS33 (OmpA rand lib 20mer) (BioMod Foundation)
gcggctg ggag actagt nnb nnb nnb nnb nnb nnb nnb nnb nnb nnb nnb nnb nnb nnb nnb nnb nnb nnb nnb nnb gctagc tgataa ctgcag cccg



OmpA1 surface expression construct in Novagen pET29b+ vector (BioMod)
vector (aaggagatatacat) - atg aaa gct act aaa ctg gta ctg ggc gcg gta atc ctg ggt tct act ctg ctg gca ggt tgc TCC AGC AAC GCT AAA ATC GAT CAG act aga aac ccg tat gtt ggc ttt gaa atg ggt tac gac tgg tta ggt cgt atg ccg tac aaa ggc agc gtt gaa aac ggt gca tac aaa gct cag ggc gtt caa ctg acc gct aaa ctg ggt tac cca atc act gac gac ctg gac atc tac act cgt ctg ggt ggc atg gta tgg cgt gca gac act aaa tcc aac gtt tat ggt aaa aac cac gac acc ggc gtt tct ccg gtc ttc gct ggc ggt gtt gag tac gcg atc act cct gaa atc gct acc cgt ctg gaa tac cag tgg acc aac aac atc ggt gac gca cac acc atc ggc act cgt ccg gac aac gctagc tgataa ctgcag aagctt - vector (gcggccgcactc)



OmpA2 surface expression construct in Novagen pET29b+ vector (BioMod)
vector(aaggagatataCAT) - ATG aaa gct act aaa ctg gta ctg ggc gga ata aac ccg tat gtt ggc ttt gaa atg ggt tac gac tgg tta ggt cgt atg ccg tac aaa ggc agc gtt gaa aac ggt gca tac aaa gct cag ggc gtt caa ctg acc gct aaa ctg ggt tac cca atc act gac gac ctg gac atc tac act cgt ctg ggt ggc atg gta tgg cgt gca gac act aaa tcc aac gtt tat ggt aaa aac cac gac acc ggc gtt tct ccg gtc ttc gct ggc ggt gtt gag tac gcg atc act cct gaa atc gct acc cgt ctg gaa tac cag tgg acc aac aac atc ggt gac gca cac acc atc ggc act cgt ccg gac aac gctagc tgataa ctgcag aagctt - vector(gcggccgcactc)



OmpA1 surface expression construct plus histidine tag in Novagen pET29b+ vector (BioMod)
vector (aaggagatatacat) - atg aaa gct act aaa ctg gta ctg ggc gcg gta atc ctg ggt tct act ctg ctg gca ggt tgc TCC AGC AAC GCT AAA ATC GAT CAG act aga aac ccg tat gtt ggc ttt gaa atg ggt tac gac tgg tta ggt cgt atg ccg tac aaa ggc agc gtt gaa aac ggt gca tac aaa gct cag ggc gtt caa ctg acc gct aaa ctg ggt tac cca atc act gac gac ctg gac atc tac act cgt ctg ggt ggc atg gta tgg cgt gca gac act aaa tcc aac gtt tat ggt aaa aac cac gac acc ggc gtt tct ccg gtc ttc gct ggc ggt gtt gag tac gcg atc act cct gaa atc gct acc cgt ctg gaa tac cag tgg acc aac aac atc ggt gac gca cac acc atc ggc act cgt ccg gac aac gctagt cat cac cac cat cat cac cat cac cac cac gctagc tgataa ctgcag aagctt - vector (gcggccgcactc)



OmpA2 surface expression construct plus histidine tag in Novagen pET29b+ vector (BioMod)
vector (aaggagatataCAT) - ATG aaa gct act aaa ctg gta ctg ggc gga ata aac ccg tat gtt ggc ttt gaa atg ggt tac gac tgg tta ggt cgt atg ccg tac aaa ggc agc gtt gaa aac ggt gca tac aaa gct cag ggc gtt caa ctg acc gct aaa ctg ggt tac cca atc act gac gac ctg gac atc tac act cgt ctg ggt ggc atg gta tgg cgt gca gac act aaa tcc aac gtt tat ggt aaa aac cac gac acc ggc gtt tct ccg gtc ttc gct ggc ggt gtt gag tac gcg atc act cct gaa atc gct acc cgt ctg gaa tac cag tgg acc aac aac atc ggt gac gca cac acc atc ggc act cgt ccg gac aac gctagt cat cac cac cat cat cac cat cac cac cac gctagc tgataa ctgcag aagctt - vector (gcggccgcactc)



OmpA1 surface expression construct plus strep2 tag in Novagen pET29b+ vector (BioMod)
vector(aaggagatatacat) - atg aaa gct act aaa ctg gta ctg ggc gcg gta atc ctg ggt tct act ctg ctg gca ggt tgc TCC AGC AAC GCT AAA ATC GAT CAG act aga aac ccg tat gtt ggc ttt gaa atg ggt tac gac tgg tta ggt cgt atg ccg tac aaa ggc agc gtt gaa aac ggt gca tac aaa gct cag ggc gtt caa ctg acc gct aaa ctg ggt tac cca atc act gac gac ctg gac atc tac act cgt ctg ggt ggc atg gta tgg cgt gca gac act aaa tcc aac gtt tat ggt aaa aac cac gac acc ggc gtt tct ccg gtc ttc gct ggc ggt gtt gag tac gcg atc act cct gaa atc gct acc cgt ctg gaa tac cag tgg acc aac aac atc ggt gac gca cac acc atc ggc act cgt ccg gac aac gctagt tgg agc cac ccg cag ttc gaa aag gctagc tgataa ctgcag aagctt - vector (gcggccgcactc)



OmpA2 surface expression construct plus strep2 tag in Novagen pET29b+ vector (BioMod)
vector(aaggagatataCAT) - ATG aaa gct act aaa ctg gta ctg ggc gga ata aac ccg tat gtt ggc ttt gaa atg ggt tac gac tgg tta ggt cgt atg ccg tac aaa ggc agc gtt gaa aac ggt gca tac aaa gct cag ggc gtt caa ctg acc gct aaa ctg ggt tac cca atc act gac gac ctg gac atc tac act cgt ctg ggt ggc atg gta tgg cgt gca gac act aaa tcc aac gtt tat ggt aaa aac cac gac acc ggc gtt tct ccg gtc ttc gct ggc ggt gtt gag tac gcg atc act cct gaa atc gct acc cgt ctg gaa tac cag tgg acc aac aac atc ggt gac gca cac acc atc ggc act cgt ccg gac aac gctagt tgg agc cac ccg cag ttc gaa aag gctagc tgataa ctgcag aagctt - vector (gcggccgcactc)



OmpA1 surface expression construct plus 15mer random library in Novagen pET29b+ vector (BioMod)
wanted construct
vector (aaggagatatacat) - atg aaa gct act aaa ctg gta ctg ggc gcg gta atc ctg ggt tct act ctg ctg gca ggt tgc TCC AGC AAC GCT AAA ATC GAT CAG act aga aac ccg tat gtt ggc ttt gaa atg ggt tac gac tgg tta ggt cgt atg ccg tac aaa ggc agc gtt gaa aac ggt gca tac aaa gct cag ggc gtt caa ctg acc gct aaa ctg ggt tac cca atc act gac gac ctg gac atc tac act cgt ctg ggt ggc atg gta tgg cgt gca gac act aaa tcc aac gtt tat ggt aaa aac cac gac acc ggc gtt tct ccg gtc ttc gct ggc ggt gtt gag tac gcg atc act cct gaa atc gct acc cgt ctg gaa tac cag tgg acc aac aac atc ggt gac gca cac acc atc ggc act cgt ccg gac aac gctagt nnb nnb nnb nnb nnb nnb nnb nnb nnb nnb nnb nnb nnb nnb nnb gctagc tgataa ctgcag aagctt - vector (gcggccgcactc)



OmpA2 surface expression construct plus 15mer random library in Novagen pET29b+ vector (BioMod)
wanted construct
vector (aaggagatataCAT) - ATG aaa gct act aaa ctg gta ctg ggc gga ata aac ccg tat gtt ggc ttt gaa atg ggt tac gac tgg tta ggt cgt atg ccg tac aaa ggc agc gtt gaa aac ggt gca tac aaa gct cag ggc gtt caa ctg acc gct aaa ctg ggt tac cca atc act gac gac ctg gac atc tac act cgt ctg ggt ggc atg gta tgg cgt gca gac act aaa tcc aac gtt tat ggt aaa aac cac gac acc ggc gtt tct ccg gtc ttc gct ggc ggt gtt gag tac gcg atc act cct gaa atc gct acc cgt ctg gaa tac cag tgg acc aac aac atc ggt gac gca cac acc atc ggc act cgt ccg gac aac gctagt nnb nnb nnb nnb nnb nnb nnb nnb nnb nnb nnb nnb nnb nnb nnb gctagc tgataa ctgcag aagctt - vector (gcggccgcactc)



OmpA + library Forward Primer (as ordered)
5’ caaa|Nde1| biobrick| 25 bases of OmpA 3’
5’caaaacatatgGAATTCGCGGCCGCtTCTAGAatgaaagctactaaactggtactgg 3’

NOTE: Non-biobrick version to be used



OmpA + 10-mer library Reverse Primer
5’ Xho1| suffix| random library| last 25 bases OmpA ‘3 (reverse complements)
5’ CTCGAGCTGCAGCGGCCGCtttaACTAGTbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnaagcttctgcagttatcagctagcg 3’



OmpA + 15-mer library Reverse Primer
5’ Xho1| suffix| random library| last 25 bases OmpA ‘3 (reverse complements)
5’ CTCGAGCTGCAGCGGCCGCtttaACTAGTbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnaagcttctgcagttatcagctagcg 3’



REVISED OmpA + 20-mer library Reverse Primer
5’ caaa|Xho1|stop|random library| last 25 bases OmpA ‘3 (reverse complements)
5’ caaaCTCGAGttabnnbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnbnnaagcttctgcagttatcagctagcg 3’




pET with AIDA-1 signal, insertion site, and AIDA-1 (update 8/24/07)
(pet29b+ vector) (Nde1) - AIDA signal - insertion site with Nhe1 and Sbf1 (compatible with Xba and Pst of normal biobricks) AIDA1 sequence -stop codon - "Not1" (pet29b+vector)
(aaggagatata)CAT ATG att aaa tta aaa ttt ggt gtt ttt ttt aca gtt tta cta tct tca gca tat gcc tac gca cat gga aca cct GCTAGC gca ggC CTGCAG Gga ctt aatcctacaa aagaaagtgc aggtaatact cttaccgtgt caaattatac tgggacaccg ggaagtgtta tttctcttgg tggtgtgctt gaaggagata attcacttac ggaccgtctg gtggtgaaag gtaatacctc tggtcaaagt gacatcgttt atgtcaatga agatggcagt ggtggtcaga cgagagatgg tattaatatt atttctgtag agggaaattc tgatgcagaa ttctctctga agaaccgcgt agttgccgga gcttatgatt acacactgca gaaaggaaac gagagtggga cagataataa gggatggtat ttaaccagtc atcttcccac atctgatacc cggcaataca gaccggagaa cggaagttat gctaccaata tggcactggc taactcactg ttcctcatgg atttgaatga gcgtaagcaa ttcagggcca tgagtgataa tacacagcct gagtctgcat ccgtgtggat gaagatcact ggaggaagaa gctctggtaa gcttaatgac gggcaaaata aaacaacaac caatcagttt atcaatcagc tcggggggga tatttataaa ttccatgctg aacaactggg tgattttacc ttagggatta tgggaggata cgcgaatgca aaaggtaaaa cgataaatta cacgagcaac aaagctgcca gaaacacact ggatggttat tctgtcgggg tatacggtac gtggtatcag aatggggaaa atgcaacagg gctctttgct gaaacttgga tgcaatataa ctggtttaat gcatcagtga aaggtgacgg actggaagaa gaaaaatata atctgaatgg tttaaccgct tctgcaggtg ggggatataa cctgaatgtg cacacatgga catcacctga aggaataaca ggtgaattct ggttgcagcc tcatttgcag gctgtctgga tgggggttac accggataca catcaggagg ataacggaac ggtggtgcag ggagcaggga aaaataatat tcagacaaaa gcaggtattc gtgcatcctg gaaggtgaaa agcaccctgg ataaggatac cgggcgggag ttccgtccgt atatagaggc aaactggatc cataacactc atgaatttgg tgttaaaatg agtgatgaca gccagttgtt gtcaggtagc cgaaatcagg gagagataaa gacaggtatt gaaggggtga ttactcaaaa cttgtcagtg aatggcggag tcgcatatca ggcaggaggt cacgggagca atgccatctc cggagcactg gggataaaat acagcttctg a GCGGCCGC (actcgagcaccacc)




pET with AIDA-1 signal, his tag, and AIDA-1 (update 8/24/07)
(pet29b+ vector) (Nde1) - AIDA signal - insertion site with his tag - AIDA1 sequence - stop codon - "Not1" (pet29b+vector)
(aaggagatata)CAT ATG att aaa tta aaa ttt ggt gtt ttt ttt aca gtt tta cta tct tca gca tat gcc tac gca cat gga aca cct GCTAGt cat cac cac cat cat cac cat cac cac cac gctagc gca ggt CTGCAG Gga ctt aatcctacaa aagaaagtgc aggtaatact cttaccgtgt caaattatac tgggacaccg ggaagtgtta tttctcttgg tggtgtgctt gaaggagata attcacttac ggaccgtctg gtggtgaaag gtaatacctc tggtcaaagt gacatcgttt atgtcaatga agatggcagt ggtggtcaga cgagagatgg tattaatatt atttctgtag agggaaattc tgatgcagaa ttctctctga agaaccgcgt agttgccgga gcttatgatt acacactgca gaaaggaaac gagagtggga cagataataa gggatggtat ttaaccagtc atcttcccac atctgatacc cggcaataca gaccggagaa cggaagttat gctaccaata tggcactggc taactcactg ttcctcatgg atttgaatga gcgtaagcaa ttcagggcca tgagtgataa tacacagcct gagtctgcat ccgtgtggat gaagatcact ggaggaagaa gctctggtaa gcttaatgac gggcaaaata aaacaacaac caatcagttt atcaatcagc tcggggggga tatttataaa ttccatgctg aacaactggg tgattttacc ttagggatta tgggaggata cgcgaatgca aaaggtaaaa cgataaatta cacgagcaac aaagctgcca gaaacacact ggatggttat tctgtcgggg tatacggtac gtggtatcag aatggggaaa atgcaacagg gctctttgct gaaacttgga tgcaatataa ctggtttaat gcatcagtga aaggtgacgg actggaagaa gaaaaatata atctgaatgg tttaaccgct tctgcaggtg ggggatataa cctgaatgtg cacacatgga catcacctga aggaataaca ggtgaattct ggttgcagcc tcatttgcag gctgtctgga tgggggttac accggataca catcaggagg ataacggaac ggtggtgcag ggagcaggga aaaataatat tcagacaaaa gcaggtattc gtgcatcctg gaaggtgaaa agcaccctgg ataaggatac cgggcgggag ttccgtccgt atatagaggc aaactggatc cataacactc atgaatttgg tgttaaaatg agtgatgaca gccagttgtt gtcaggtagc cgaaatcagg gagagataaa gacaggtatt gaaggggtga ttactcaaaa cttgtcagtg aatggcggag tcgcatatca ggcaggaggt cacgggagca atgccatctc cggagcactg gggataaaat acagcttctg a GCGGCCGC (actcgagcaccacc)





pET with AIDA-1 signal, strep2 tag, and AIDA-1 (update 8/24/07)
(pet29b+ vector) (Nde1) - AIDA signal - insertion site with strep2 tag - AIDA1 sequence - stop codon - "Not1" (pet29b+vector)
(aaggagatata)CAT ATG att aaa tta aaa ttt ggt gtt ttt ttt aca gtt tta cta tct tca gca tat gcc tac gca cat gga aca cct GCTAGt tgg agc cac ccg cag ttc gaa aag gctagc gca ggt CTGCAG Gga ctt aatcctacaa aagaaagtgc aggtaatact cttaccgtgt caaattatac tgggacaccg ggaagtgtta tttctcttgg tggtgtgctt gaaggagata attcacttac ggaccgtctg gtggtgaaag gtaatacctc tggtcaaagt gacatcgttt atgtcaatga agatggcagt ggtggtcaga cgagagatgg tattaatatt atttctgtag agggaaattc tgatgcagaa ttctctctga agaaccgcgt agttgccgga gcttatgatt acacactgca gaaaggaaac gagagtggga cagataataa gggatggtat ttaaccagtc atcttcccac atctgatacc cggcaataca gaccggagaa cggaagttat gctaccaata tggcactggc taactcactg ttcctcatgg atttgaatga gcgtaagcaa ttcagggcca tgagtgataa tacacagcct gagtctgcat ccgtgtggat gaagatcact ggaggaagaa gctctggtaa gcttaatgac gggcaaaata aaacaacaac caatcagttt atcaatcagc tcggggggga tatttataaa ttccatgctg aacaactggg tgattttacc ttagggatta tgggaggata cgcgaatgca aaaggtaaaa cgataaatta cacgagcaac aaagctgcca gaaacacact ggatggttat tctgtcgggg tatacggtac gtggtatcag aatggggaaa atgcaacagg gctctttgct gaaacttgga tgcaatataa ctggtttaat gcatcagtga aaggtgacgg actggaagaa gaaaaatata atctgaatgg tttaaccgct tctgcaggtg ggggatataa cctgaatgtg cacacatgga catcacctga aggaataaca ggtgaattct ggttgcagcc tcatttgcag gctgtctgga tgggggttac accggataca catcaggagg ataacggaac ggtggtgcag ggagcaggga aaaataatat tcagacaaaa gcaggtattc gtgcatcctg gaaggtgaaa agcaccctgg ataaggatac cgggcgggag ttccgtccgt atatagaggc aaactggatc cataacactc atgaatttgg tgttaaaatg agtgatgaca gccagttgtt gtcaggtagc cgaaatcagg gagagataaa gacaggtatt gaaggggtga ttactcaaaa cttgtcagtg aatggcggag tcgcatatca ggcaggaggt cacgggagca atgccatctc cggagcactg gggataaaat acagcttctg a GCGGCCGC (actcgagcaccacc)




Biobricked OmpA with an NheI site at beginning of loop one
gggcgaattgggtaccgaattcgcggccgcttctagaatgaaaaagacagctatcgcgattgcagtggcactggctggtttcgctaccgtagcgcaggccgctccgaaagataacacctggtacactggtgctaaactgggctggtcccagtaccatgacactggtttcatcgctagcaatggcccgacccatgaaaaccaactgggcgctggtgcttttggtggttaccaggttaacccgtatgttggctttgaaatgggttacgactggttaggtcgtatgccgtacaaaggcagcgttgaaaacggtgcatacaaagctcagggcgttcaactgaccgctaaactgggttacccaatcactgacgacctggacatctacactcgtctgggtggcatggtatggcgtgcagacactaaatccaacgtttatggtaaaaaccacgacaccggcgtttctccggtcttcgctggcggtgttgagtacgcgatcactcctgaaatcgctacccgtctggaataccagtggaccaacaacatcggtgacgcacacaccatcggcactcgtccggacaacggcatgctgagcctgggtgtttcctaccgtttcggtcagggcgaagcagctccagtagttgctccggctccagctccggcaccggaagtacagaccaagcacttcactctgaagtctgacgttctgttcaacttcaacaaagcaaccctgaaaccggaaggtcaggctgctctggatcagctgtacagccagctgagcaacctggatccgaaagacggttccgtagttgttctgggttacaccgaccgcatcggttctgacgcttacaaccagggtctgtccgagcgccgtgctcagtctgttgttgattacctgatctccaaaggtatcccggcagacaagatctccgcacgtggtatgggcgaatccaacccggttactggcaacacctgtgacaacgtgaaacagcgtgctgcactgatcgactgcctggctccggatcgtcgcgtagagatcgaagttaaaggtatcaaagacgttgtaactcagccgcaggctactagttaaagcggccgctgcagagctccagcttttgttccc3'


Personal tools