IGEM:Harvard/2007/Two Component Systems

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
m (Completed Work)
m (Completed Work)
Line 4: Line 4:
== Completed Work ==
== Completed Work ==
-
Ordered oligos to create a FecA promoter BioBrick that can be used to recombine with GFP to create a reporter system.  
+
6/27/07 - Ordered oligos to create a FecA promoter BioBrick that can be used to recombine with GFP to create a reporter system.  
The oligos ordered were as follows:
The oligos ordered were as follows:
Line 13: Line 13:
5’-
5’-
GTTTCTTCCTGCAGCGGCCGCTACTAGTAAGGGTAAAAAGGACAATCGAAATAAGAATTATTT – 3’
GTTTCTTCCTGCAGCGGCCGCTACTAGTAAGGGTAAAAAGGACAATCGAAATAAGAATTATTT – 3’
 +
 +
 +
 +
6/27/07 - Miniprepped bacteria (FecA, FecI, FecR) to prepare for sequencing tomorrow, inoculation in 2 ml LB and 2 ul amp 50mg/ml 1000x.
== Brainstorming ==
== Brainstorming ==

Revision as of 17:02, 27 June 2007

Contents

FecA Two Component System

Planned Work

Completed Work

6/27/07 - Ordered oligos to create a FecA promoter BioBrick that can be used to recombine with GFP to create a reporter system.

The oligos ordered were as follows: Construct 1 5’- GTTTCTTCGAATTCGCGGCCGCTTCTAGAGatttcaccactgtaaggaaaataattcttatttc – 3’

Construct 2 5’- GTTTCTTCCTGCAGCGGCCGCTACTAGTAAGGGTAAAAAGGACAATCGAAATAAGAATTATTT – 3’


6/27/07 - Miniprepped bacteria (FecA, FecI, FecR) to prepare for sequencing tomorrow, inoculation in 2 ml LB and 2 ul amp 50mg/ml 1000x.

Brainstorming

Initial Plan (6/25/07)

Readings

  1. Koebnik R, Locher KP, and Van Gelder P. . pmid:10931321. PubMed HubMed [FecAPorins1]
  2. Vica Pacheco S, García González O, and Paniagua Contreras GL. . pmid:9368371. PubMed HubMed [FecAPorins2]
  3. Wimley WC. . pmid:12948769. PubMed HubMed [FecAPorins3]
  4. Braun V, Mahren S, and Sauter A. . pmid:16718597. PubMed HubMed [FecAPorins4]
  5. Ferguson AD, Amezcua CA, Halabi NM, Chelliah Y, Rosen MK, Ranganathan R, and Deisenhofer J. . pmid:17197416. PubMed HubMed [FecAPorins5]
  6. Braun V, Mahren S, and Sauter A. . pmid:16718597. PubMed HubMed [FecAPorins6]
  7. Ferguson AD, Chakraborty R, Smith BS, Esser L, van der Helm D, and Deisenhofer J. . pmid:11872840. PubMed HubMed [FecAPorins7]
  8. Sauter A and Braun V. . pmid:15292131. PubMed HubMed [FecAPorins8]
  9. Yue WW, Grizot S, and Buchanan SK. . pmid:12948487. PubMed HubMed [FecAPorins9]
  10. Garcia-Herrero A and Vogel HJ. . pmid:16313612. PubMed HubMed [FecAPorins10]
  11. Breidenstein E, Mahren S, and Braun V. . pmid:16923915. PubMed HubMed [FecAPorins11]
  12. Russ WP, Lowery DM, Mishra P, Yaffe MB, and Ranganathan R. . pmid:16177795. PubMed HubMed [FecAPorins12]
All Medline abstracts: PubMed HubMed
Personal tools