IGEM:Harvard/2007/Two Component Systems

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
m (Completed Work)
m (Readings)
Line 36: Line 36:
#FecAPorins11 pmid=16923915
#FecAPorins11 pmid=16923915
#FecAPorins12 pmid=16177795
#FecAPorins12 pmid=16177795
 +
#FecAPorins13 pmid=12736688
 +
#FecAPorins14 pmid=14500902
 +
#FecAPorins15 pmid=11243829
 +
#FecAPorins16 pmid=17208966
</biblio>
</biblio>

Revision as of 17:06, 27 June 2007

Contents

FecA Two Component System

Planned Work

Completed Work

6/27/07 - Ordered oligos to create a FecA promoter BioBrick that can be used to recombine with GFP to create a reporter system.

The oligos ordered were as follows: Construct 1 5’- GTTTCTTCGAATTCGCGGCCGCTTCTAGAGatttcaccactgtaaggaaaataattcttatttc – 3’

Construct 2 5’- GTTTCTTCCTGCAGCGGCCGCTACTAGTAAGGGTAAAAAGGACAATCGAAATAAGAATTATTT – 3’


6/27/07 - Miniprepped bacteria (FecA, FecI, FecR) to prepare for sequencing tomorrow, inoculation in 2 ml LB and 2 ul amp 50mg/ml 1000x.

Brainstorming

Initial Plan (6/25/07)

Readings

Error fetching PMID 10931321:
Error fetching PMID 9368371:
Error fetching PMID 12948769:
Error fetching PMID 16718597:
Error fetching PMID 17197416:
Error fetching PMID 16718597:
Error fetching PMID 11872840:
Error fetching PMID 15292131:
Error fetching PMID 12948487:
Error fetching PMID 16313612:
Error fetching PMID 16923915:
Error fetching PMID 16177795:
Error fetching PMID 12736688:
Error fetching PMID 14500902:
Error fetching PMID 11243829:
Error fetching PMID 17208966:
  1. Error fetching PMID 10931321: [FecAPorins1]
  2. Error fetching PMID 9368371: [FecAPorins2]
  3. Error fetching PMID 12948769: [FecAPorins3]
  4. Error fetching PMID 16718597: [FecAPorins4]
  5. Error fetching PMID 17197416: [FecAPorins5]
  6. Error fetching PMID 16718597: [FecAPorins6]
  7. Error fetching PMID 11872840: [FecAPorins7]
  8. Error fetching PMID 15292131: [FecAPorins8]
  9. Error fetching PMID 12948487: [FecAPorins9]
  10. Error fetching PMID 16313612: [FecAPorins10]
  11. Error fetching PMID 16923915: [FecAPorins11]
  12. Error fetching PMID 16177795: [FecAPorins12]
  13. Error fetching PMID 12736688: [FecAPorins13]
  14. Error fetching PMID 14500902: [FecAPorins14]
  15. Error fetching PMID 11243829: [FecAPorins15]
  16. Error fetching PMID 17208966: [FecAPorins16]
All Medline abstracts: PubMed HubMed
Personal tools