IGEM:Harvard/2007/Two Component Systems

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
m (Readings)
m (Completed Work)
Line 42: Line 42:
Dr. Costas D. Maranas
Dr. Costas D. Maranas
Dr. Gregory L. Moore
Dr. Gregory L. Moore
 +
 +
 +
PCR extension of constructs 1 and 2
 +
-3 cycles of PCR
 +
-diluted first to 500 uM, then to 20 uM
 +
-15 uL of water, 10 uL of DNA, 25 uL of PCR master mix for each.
 +
-two redundant reactions, R1 and R2
 +
-R2 may be wrong becuase of volume errors
== Brainstorming ==
== Brainstorming ==

Revision as of 15:26, 3 July 2007

Contents

FecA Two Component System

In the beginning, our team decided to use cells as biosensors, used to bind to targets, like breast cancer cells. We were later compelled to up the ante. So, we directed our thinking toward a 2 component system where E Coli would bind to a target and then produce a reporting signal. From this came the search for E Coli outer membrane receptors that are already part of a signally pathway, trying to do as little signal pathway re-engineering as possible. There are very few outer membrane receptors that suit our purpose. In fact, there is only one that we could find: FecA.

Using the FecA receptor from the outer membrane of Escherichia Coli, we hope to bind to given targets and produce a reporting signal. We originally planned to insert a random peptide library into the FecA protein and see which n-mer binds to our target. And this receptor-ligand binding should set off the FecA signalling pathway. The concerns presented are:

1) Where should the random library be inserted? FecA has several loops which serve as potential sites for insertion. Literature suggests that the conformational changes of loops 7 and 8 are most critical to binding and signal production. So then, would it be best to insert a library into these loops? Would it be best to use several locations and several libraries at once to get the correct response?

2) Random library insertion is a game of chance, given the number of possibilities that can be produced and biases in different methods of producing random libraries. And how does the insertion of new peptides effect specificity? THUS....

3) Computational methods of predicting which sequences produce the desired binding and signal are attractive, but are at this point unknown to us. These methods (IPRO, CHARMM, dead end elimination) have not been attempted with FecA, as far as we can tell. They are also fairly new methods. Our advantage is that FecA is well characterized liganded and unliganded, which is much easier than creating a protein from scratch that will bind to a particular target. In this vein, we have contacted several researchers who have produced papers on computational design of proteins, receptors in particular.

Planned Work

Completed Work

6/27/07

Ordered oligos to create a FecA promoter BioBrick that can be used to recombine with GFP to create a reporter system.

The oligos ordered were as follows: Construct 1 5’- GTTTCTTCGAATTCGCGGCCGCTTCTAGAGatttcaccactgtaaggaaaataattcttatttc – 3’

Construct 2 5’- GTTTCTTCCTGCAGCGGCCGCTACTAGTAAGGGTAAAAAGGACAATCGAAATAAGAATTATTT – 3’


Grew bacteria (FecA, FecI, FecR) in liquid culture to prepare for Miniprep and sequencing tomorrow. Inoculation in 2 ml LB and 2 ul amp 50mg/ml 1000x.


6/28/07 Miniprep done. Sent for sequencing.

Emails sent to:

Duke: Dr. Homme W. Hellinga Dr. Loren L. Looger

Penn State: Dr. Hossein Fazelinia Dr. Costas D. Maranas Dr. Gregory L. Moore


PCR extension of constructs 1 and 2 -3 cycles of PCR -diluted first to 500 uM, then to 20 uM -15 uL of water, 10 uL of DNA, 25 uL of PCR master mix for each. -two redundant reactions, R1 and R2 -R2 may be wrong becuase of volume errors

Brainstorming

6/28/07

Given the complexity of reengineering a receptor binding site such that it binds with a target other than its wild type ligand, we could create a "negative gate." The target will block ferric citrate from binding, thus turning off the FecA signal. Loops 9 and 10 look promising because they are accessible and do not participate in the binding of ferric citrate (they do not contain binding residues). Loop 11 would be another choice except that it has binding residues.

Readings

Error fetching PMID 10931321:
Error fetching PMID 9368371:
Error fetching PMID 12948769:
Error fetching PMID 16718597:
Error fetching PMID 17197416:
Error fetching PMID 16718597:
Error fetching PMID 11872840:
Error fetching PMID 15292131:
Error fetching PMID 12948487:
Error fetching PMID 16313612:
Error fetching PMID 16923915:
Error fetching PMID 16177795:
Error fetching PMID 12736688:
Error fetching PMID 14500902:
Error fetching PMID 11243829:
Error fetching PMID 17208966:
Error fetching PMID 16513775:
Error fetching PMID 9826510:
  1. Error fetching PMID 10931321: [FecAPorins1]
  2. Error fetching PMID 9368371: [FecAPorins2]
  3. Error fetching PMID 12948769: [FecAPorins3]
  4. Error fetching PMID 16718597: [FecAPorins4]
  5. Error fetching PMID 17197416: [FecAPorins5]
  6. Error fetching PMID 16718597: [FecAPorins6]
  7. Error fetching PMID 11872840: [FecAPorins7]
  8. Error fetching PMID 15292131: [FecAPorins8]
  9. Error fetching PMID 12948487: [FecAPorins9]
  10. Error fetching PMID 16313612: [FecAPorins10]
  11. Error fetching PMID 16923915: [FecAPorins11]
  12. Error fetching PMID 16177795: [FecAPorins12]
  13. Error fetching PMID 12736688: [FecAPorins13]
  14. Error fetching PMID 14500902: [FecAPorins14]
  15. Error fetching PMID 11243829: [FecAPorins15]
  16. Error fetching PMID 17208966: [FecAPorins16]
  17. Error fetching PMID 16513775: [FecAPorins17]
  18. Error fetching PMID 9826510: [FecAPorins18]
All Medline abstracts: PubMed HubMed
Personal tools