IGEM:Harvard/2008/Lab Notebooks/DailyBook/Week0

Monday: June 16, 2008

Meeting Notes

Tic-Tac-Toe

Basic Idea

• Use a chemical signal to induce electric output
• Use E. coli as detector, Shewie as indicator
• Use E. coli to produce lactate, needed for e- production in Shewie

Logistics of Game

Person v. Person

• Example game:

1. Player 1 adds chemical
2. Computer tracks electric output and displays move on screen
3. Player 2 adds chemical
4. Computer tracks electric output and displays move on screen
5. Repeat

• One chemical detection needed

Person v. Computer

• Example game:

1. Player 1 adds chemical
2. Computer tracks electric output and displays move on screen
3. Computer chooses its move and lights up the well that it decides to move to
4. Bacteria respond in a certain way
5. Repeat

• One chemical detection and one light detection needed

Person v. Bacteria

• Most complex, based off of DNA paper (See here)
• Applying ideas from DNA paper to bacteria
• Create 8 strains of different antibiotic resistances
• More feasible in E. coli than in Shewie

Tuesday: June 17, 2008

• GFP/OD Measurement (results)
• Make glycerol stocks
• Miniprep vectors (protocol)
• Make competent Shewie
  • Chemically competent (protocol)
  • Electrocompetent (protocol)
• Pour CM plates
• Transform Shewie with pACYC Duet and GFP vectors

Name	Registry Name	Description	Origin	Size	Marker
E1	J23113	Low promoter GFP tester	pMB1	35	Kan
E2	J23150	Medium promoter GFP tester	pMB1	35	Kan
E3	J23151	High promoter GFP tester	pMB1	35	Kan
E4	pACYC duet	Low-Medium copy vector	p15a	4008	Cm

For list of all parts, see here.

Wednesday: June 18, 2008

• Cloning Strategy
  • Punch out from registry

Name	Registry Name	Description	Origin	Size	Marker
E5	pSB3K3	Low-Medium copy vector	p15a	2750	Kan
E6	BBa-E1010	RFP only	pMB1	681	Kan
E7	pSB1A2	GFP only	pMB1	2079	Amp
E8	BBa_J04450	RFP with LacI promoter	pMB1	1069	Amp
E9	BBa_J04430	GFP with LacI promoter	pMB1	1083	Amp
E10	BBa_I715038	T7 Polymerase with LacI promoter	pMB1	2878	Amp

For list of all parts, see here.

• transform into E. coli TOP10 cells

• Make chemically and electrocompetent Shewie MR-1
• Transform electrocompetent Shewie MR-1

Thursday: June 19, 2008

Results from Electroporated Shewie and E. coli plates

• Shewie
  • P3 J23151 (Kan) colonies grew and expressed GFP; colonies may have a pinkish tint; unexpected b/c origin of replication
  • P4 pACYC-Duet (Cm) colonies grew
  • P5 pSB3K3 (Kan) no growth, possibly due to the very small volume of DNA added
  • A1 (Cm) a few colonies grew
• TOP10
  • P3 J23151 (Kan)
  • P4 pACYC-Duet (Cm)
  • A1 (Cm)

Restreaking electroporated E. coli plates

Some plates were overgrown (lawns/colonies too dense), so they were replated

• P4 pACYC-Duet (Cm) restreaked from lawn onto 1000x dilution chloramphenicol plate)
• P7 pSB1A2 one big and one small colony onto 2 ampicillin plates
• P8 BBa_J04450 one big and one small colony onto 2 ampicillin plates
• P9 BBa_J04430 one big and one small colony onto 2 ampicillin plates
• P10 BBa_I715038 one big and one small colony onto 2 ampicillin plates

Some plates didn't have any visible colonies

S1 & E1 DNA Alignment

Thu Jun 19 15:45:18 2008
E. coli K12-DH108 from 1 to 1542
Alignment to
Shewanella oneidensis MR-1 from 1 to 1529
Matches(|):1384
Mismatches(#):95
Gaps( ):113
Unattempted(.):0

    1 aaattgaagagtttgatcatggctcagattgaacgctggcggcaggcctaacacatgcaa 60    
      |         ||||||||||||||||||||||||||||||||||||||||||||||||||       
    1 a---------gtttgatcatggctcagattgaacgctggcggcaggcctaacacatgcaa 51    

   61 gtcgaacggta--ac-ag-gaagaagcttgct--tc-tttgctgacgagtggcggacggg 113   
      |||||#|||#|  || || | ||    ||  |  || |##|#||#||||#||||||||||       
   52 gtcgagcggcagcacaagtg-ag----tt--tactcatgaggtggcgagcggcggacggg 104   

  114 tgagtaatgtct-gggaaactgcctga-tggagggggataacta-ctggaaacggta--g 168   
      |||||||||#|| ||| |#||||| #| |#|||||||||||| | #||||||||  |  |       
  105 tgagtaatgcctaggg-atctgcc-cagtcgagggggataac-agttggaaacg--actg 159   

  169 ctaataccgcataacgtcgc--a-agaccaaagagggggaccttcgggcctcttgccatc 225   
      |||||||||||| ||| | |  | #|###||||||||||||#|||||||||||#||#||#       
  160 ctaataccgcat-acg-c-cctacgggggaaagagggggactttcgggcctctcgcgatt 216   

  226 ggatgtgcccagatgggattagctagtaggtggggtaacggctcacctaggcgacgatcc 285   
      |||||##||#||#||||||||||||||#||||#|||||#||||||||#||||||||||||       
  217 ggatgaacctaggtgggattagctagttggtgaggtaatggctcaccaaggcgacgatcc 276   

  286 ctagctggtctgagaggatgaccagccacactggaactgagacacggtccagactcctac 345   
      |||||||#|||||||||||||#||||||||||||#||||||||||||#||||||||||||       
  277 ctagctgttctgagaggatgatcagccacactgggactgagacacggcccagactcctac 336   

  346 gggaggcagcagtggggaatattgcacaatgggcgcaagcctgatgcagccatgccgcgt 405   
      |||||||||||||||||||||||||||||||||#|#||#|||||||||||||||||||||       
  337 gggaggcagcagtggggaatattgcacaatgggggaaaccctgatgcagccatgccgcgt 396   

  406 gtatgaagaaggccttcgggttgtaaagtactttcagcggggagg-aagggagtaaagt- 463   
      ||#|||||||||||||||||||||||||#||||||||##|||||| ||||  || ||||        
  397 gtgtgaagaaggccttcgggttgtaaagcactttcagtagggaggaaagg--gt-aagtc 453   

  464 -taatac--ctt-tgctcattgacgttacccgcagaagaagcaccggctaactccgtgcc 519   
       ||||||  ||| | ||  #||||||||||##|||||||||#||||||||||||||||||       
  454 ctaatacgacttat-ct--gtgacgttacctacagaagaaggaccggctaactccgtgcc 510   

  520 agcagccgcggtaatacggagggtgcaagcgttaatcggaattactgggcgtaaagcgca 579   
      ||||||||||||||||||||||||#|#|||||||||||||||||||||||||||||||##       
  511 agcagccgcggtaatacggagggtccgagcgttaatcggaattactgggcgtaaagcgtg 570   

  580 cgcaggcggtttgttaagtc-agatgtgaaatccccgggctcaacctgggaact-gcatc 637   
      |||||||||||||||||| | ||||||||||#|||#|||||||||||#|||| | ||||        
  571 cgcaggcggtttgttaag-cgagatgtgaaagccctgggctcaacctaggaa-tcgcat- 627   

  638 t--gatactg-gcaagcttgagtctcgtagaggggggtagaattccaggtgtagcggtga 694   
      |  || |||| #||| ||#||||||#||||||||||||||||||||||||||||||||||       
  628 ttcga-actgaccaa-ctagagtcttgtagaggggggtagaattccaggtgtagcggtga 685   

  695 aatgcgtagagatctggaggaataccggtggcgaaggcggccccctggacgaagactgac 754   
      ||||||||||||||||||||||||||||||||||||||||||||||||||#|||||||||       
  686 aatgcgtagagatctggaggaataccggtggcgaaggcggccccctggacaaagactgac 745   

  755 gctcaggtg--cgaaagcgtggggagcaaacaggattagataccctggtagtccacgccg 812   
      |||||  ||  |||||||||||||||||||||||||||||||||||||||||||||||||       
  746 gctca--tgcacgaaagcgtggggagcaaacaggattagataccctggtagtccacgccg 803   

  813 taaacgatgtcgacttggaggtt--gtgcccttgaggc-gt-ggct-tccggagctaacg 867   
      |||||||||||#|||#||| |||  ||| #||||| #| #| |||| ||  #||||||||       
  804 taaacgatgtctactcgga-gtttggtg-tcttga-acactgggctctc--aagctaacg 858   

  868 cgttaagtcgaccgcctggggagtacggccgcaaggttaaaactcaaatgaattgacggg 927   
      |#||||||#|||||||||||||||||||||||||||||||||||||||||||||||||||       
  859 cattaagtagaccgcctggggagtacggccgcaaggttaaaactcaaatgaattgacggg 918   

  928 ggcccgcacaagcggtggagcatgtggtttaattcgatgcaacgcgaagaaccttacctg 987   
      |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||#       
  919 ggcccgcacaagcggtggagcatgtggtttaattcgatgcaacgcgaagaaccttaccta 978   

  988 gtcttgacatccacaga--actttccagagatg-gattggtgccttcgggaactgtgaga 1044  
      #|||||||||||||#||  ||  |#|||||||| |#|| ||||||||||||||#||||||       
  979 ctcttgacatccacggaagac--tgcagagatgcggtt-gtgccttcgggaaccgtgaga 1035  

 1045 caggtgctgcatggctgtcgtcagctcgtgttgtgaaatgttgggttaagtcccgcaacg 1104  
      ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       
 1036 caggtgctgcatggctgtcgtcagctcgtgttgtgaaatgttgggttaagtcccgcaacg 1095  

 1105 agcgcaacccttat-ctt-ttgttgccagc-ggt-ccggccgggaactcaaaggagactg 1160  
      ||||||||||#||| ||| |  |||||||| #|| ##|| #||||||||#|#||||||||       
 1096 agcgcaacccctatccttat--ttgccagcacgtaatgg-tgggaactctagggagactg 1152  

 1161 ccagtgataaactggaggaaggtggggatgacgtcaagtcatcatggcccttacgaccag 1220  
      ||#|||||||||#|||||||||||||||#|||||||||||||||||||||||||||##||       
 1153 ccggtgataaaccggaggaaggtggggacgacgtcaagtcatcatggcccttacgagtag 1212  

 1221 ggctacacacgtgctacaatggcgca-tacaaagag-------aagcgacctcgcgagag 1272  
      |||||||||||||||||||||||| | |||  ||||       ||||     |||||| |       
 1213 ggctacacacgtgctacaatggcg-agtac--agagggttgcaaagc-----cgcgag-g 1263  

 1273 -caagcggacctcataaag-tgcgtcgtagtccggattggagtctgcaactcgactccat 1330  
       ##|||##|#||||#|||| | ||||||||||||||||||||||||||||||||||||||       
 1264 tggagctaatctcacaaagct-cgtcgtagtccggattggagtctgcaactcgactccat 1322  

 1331 gaagtcggaatcgctagtaatcgtggatcagaatgccacggtgaatacgttcccgggcct 1390  
      ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       
 1323 gaagtcggaatcgctagtaatcgtggatcagaatgccacggtgaatacgttcccgggcct 1382  

 1391 tgtacacaccgcccgtcacaccatgggagtgggttgcaaaagaagtaggtagcttaacct 1450  
      |||||||||||||||||||||||||||||||||#||||||||||||#|||||||||||||       
 1383 tgtacacaccgcccgtcacaccatgggagtgggctgcaaaagaagtgggtagcttaacct 1442  

 1451 tcgggagggcgcttaccactttgtgattcatgactggggtgaagtcgtaacaaggtaacc 1510  
      |||||#|||||||#|||||||||||#|||||||||||||||||||||||||||||||#||       
 1443 tcgggggggcgctcaccactttgtggttcatgactggggtgaagtcgtaacaaggtagcc 1502  

 1511 gtaggggaacctgcggttggatcacctcctta 1542  
      #||||||||||||#||#||||||||||            
 1503 ctaggggaacctggggctggatcacct 1529

We attempted to transform TOP 10 E. coli with the light sensor biobrick (to make P11). No colonies were visible the next morning. This is perhaps because the DNA turned pink after being punched out of the notebook.