IGEM:Harvard/2008/Lab Notebooks/DailyBook/Week0

Monday: June 16, 2008

Meeting Notes

Tic-Tac-Toe

Basic Idea

• Use a chemical signal to induce electric output
• Use E. coli as detector, Shewie as indicator
• Use E. coli to produce lactate, needed for e- production in Shewie

Logistics of Game

Person v. Person

• Example game:

1. Player 1 adds chemical
2. Computer tracks electric output and displays move on screen
3. Player 2 adds chemical
4. Computer tracks electric output and displays move on screen
5. Repeat

• One chemical detection needed

Person v. Computer

• Example game:

1. Player 1 adds chemical
2. Computer tracks electric output and displays move on screen
3. Computer chooses its move and lights up the well that it decides to move to
4. Bacteria respond in a certain way
5. Repeat

• One chemical detection and one light detection needed

Person v. Bacteria

• Most complex, based off of DNA paper (See here)
• Applying ideas from DNA paper to bacteria
• Create 8 strains of different antibiotic resistances
• More feasible in E. coli than in Shewie

Lab

• picked colonies
• rehydrated MR-1 shewie strain

Tuesday: June 17, 2008

• GFP/OD Measurement (results)
• Make glycerol stocks
• Miniprep vectors (protocol)
• Make competent Shewie
  • Chemically competent (protocol) - actually used Zymo protocol which didn't work for Shewie and I don't think for E. coli
  • Electrocompetent (protocol) - actually used earlier protocol w/o sorbitol
• Pour CM plates
• Transform Shewie with pACYC Duet and GFP vectors

Name	Registry Name	Description	Origin	Size	Marker
E1	J23113	Low promoter GFP tester	pMB1	35	Kan
E2	J23150	Medium promoter GFP tester	pMB1	35	Kan
E3	J23151	High promoter GFP tester	pMB1	35	Kan
E4	pACYC duet	Low-Medium copy vector	p15a	4008	Cm

For list of all parts, see here.

Wednesday: June 18, 2008

Protocols

• Cloning Strategy
  • Punch out from registry

Name	Registry Name	Description	Origin	Size	Marker
E5	pSB3K3	Low-Medium copy vector	p15a	2750	Kan
E6	BBa-E1010	RFP only	pMB1	681	Kan
E7	pSB1A2	GFP only	pMB1	2079	Amp
E8	BBa_J04450	RFP with LacI promoter	pMB1	1069	Amp
E9	BBa_J04430	GFP with LacI promoter	pMB1	1083	Amp
E10	BBa_I715038	T7 Polymerase with LacI promoter	pMB1	2878	Amp

For list of all parts, see here.

• transform into E. coli TOP10 cells

• Make chemically and electrocompetent Shewie MR-1
• Transform electrocompetent Shewie MR-1 and E. coli
  • P3, P4, P5, A1 in shewie
  • P3, P4, A1 in E. coli (TOP10)

Results

• Results for Tuesday's (6/17) transformations
  • Results for Electrocompetent cells (first procedure no sorbitol)
    • P4 (pACYC) worked for both Shewie and E. coli; E. coli had a much higher density of coloniew
    • None of the other plasmids worked for either Shewie or E. coli cells grew (likely due to low concentrations of cells)
  • Results for Chemically competent cells (w/ Zymo procedure)
    • No Shewie (5) or E. coli (2) cells grew

Thursday: June 19, 2008

Results from Electroporated Shewie and E. coli plates

• Shewie
  • P3 J23151 (Kan) colonies grew and expressed GFP; colonies may have a pinkish tint; unexpected b/c origin of replication
  • P4 pACYC-Duet (Cm) colonies grew
  • P5 pSB3K3 (Kan) no growth, possibly due to the very small volume of DNA added
  • A1 (Cm) a few colonies grew
• TOP10
  • P3 J23151 (Kan) - colonies grew
  • P4 pACYC-Duet (Cm) - a little growth
  • A1 (Cm) - colonies grew

Results TOP10 transformations w/ registry parts

• P4 lawn
• P5 no growth?
• P6 no growth?
• P7 many small colonies
• P8 many small colonies
• P9 many small colonies
• P10 many small colonies

Restreaking electroporated E. coli plates

Some plates were overgrown (lawns/colonies too dense), so they were replated

• P4 pACYC-Duet (Cm) restreaked from lawn onto 1000x dilution chloramphenicol plate)
• P7 pSB1A2 one big and one small colony onto 2 ampicillin plates
• P8 BBa_J04450 one big and one small colony onto 2 ampicillin plates
• P9 BBa_J04430 one big and one small colony onto 2 ampicillin plates
• P10 BBa_I715038 one big and one small colony onto 2 ampicillin plates

Some plates didn't have any visible colonies

S1 & E1 DNA Alignment

Thu Jun 19 15:45:18 2008
E. coli K12-DH108 from 1 to 1542
Alignment to
Shewanella oneidensis MR-1 from 1 to 1529
Matches(|):1384
Mismatches(#):95
Gaps( ):113
Unattempted(.):0

Primers

	Sequence	Location
To distinguish S1
Forward	tcttgaacactgggctctca	831-850
Reverse	cttatttgccagcacgtaat	1111-1130
	attacgtgctggcaaataag	reverse complement for reverse primer
To distinguish E1
Forward	acagaactttccagagatgg	999-1018
Reverse	agcaagcggacctcataaag	1271-1290
	ctttatgaggtccgcttgct	reverse complement for reverse primer
Common Primer
Forward	ttgggttaagtcccgcaacg	1085-1104
Reverse	aatcgtggatcagaatgcca	1341-1360
	tggcattctgatccacgatt	reverse complement for reverse primer

    1 aaattgaagagtttgatcatggctcagattgaacgctggcggcaggcctaacacatgcaa 60    
      |         ||||||||||||||||||||||||||||||||||||||||||||||||||       
    1 a---------gtttgatcatggctcagattgaacgctggcggcaggcctaacacatgcaa 51    


   61 gtcgaacggta--ac-ag-gaagaagcttgct--tc-tttgctgacgagtggcggacggg 113   
      |||||#|||#|  || || | ||    ||  |  || |##|#||#||||#||||||||||       
   52 gtcgagcggcagcacaagtg-ag----tt--tactcatgaggtggcgagcggcggacggg 104   


  114 tgagtaatgtct-gggaaactgcctga-tggagggggataacta-ctggaaacggta--g 168   
      |||||||||#|| ||| |#||||| #| |#|||||||||||| | #||||||||  |  |       
  105 tgagtaatgcctaggg-atctgcc-cagtcgagggggataac-agttggaaacg--actg 159   


  169 ctaataccgcataacgtcgc--a-agaccaaagagggggaccttcgggcctcttgccatc 225   
      |||||||||||| ||| | |  | #|###||||||||||||#|||||||||||#||#||#       
  160 ctaataccgcat-acg-c-cctacgggggaaagagggggactttcgggcctctcgcgatt 216   


  226 ggatgtgcccagatgggattagctagtaggtggggtaacggctcacctaggcgacgatcc 285   
      |||||##||#||#||||||||||||||#||||#|||||#||||||||#||||||||||||       
  217 ggatgaacctaggtgggattagctagttggtgaggtaatggctcaccaaggcgacgatcc 276   


  286 ctagctggtctgagaggatgaccagccacactggaactgagacacggtccagactcctac 345   
      |||||||#|||||||||||||#||||||||||||#||||||||||||#||||||||||||       
  277 ctagctgttctgagaggatgatcagccacactgggactgagacacggcccagactcctac 336   


  346 gggaggcagcagtggggaatattgcacaatgggcgcaagcctgatgcagccatgccgcgt 405   
      |||||||||||||||||||||||||||||||||#|#||#|||||||||||||||||||||       
  337 gggaggcagcagtggggaatattgcacaatgggggaaaccctgatgcagccatgccgcgt 396   


  406 gtatgaagaaggccttcgggttgtaaagtactttcagcggggagg-aagggagtaaagt- 463   
      ||#|||||||||||||||||||||||||#||||||||##|||||| ||||  || ||||        
  397 gtgtgaagaaggccttcgggttgtaaagcactttcagtagggaggaaagg--gt-aagtc 453   


  464 -taatac--ctt-tgctcattgacgttacccgcagaagaagcaccggctaactccgtgcc 519   
       ||||||  ||| | ||  #||||||||||##|||||||||#||||||||||||||||||       
  454 ctaatacgacttat-ct--gtgacgttacctacagaagaaggaccggctaactccgtgcc 510   


  520 agcagccgcggtaatacggagggtgcaagcgttaatcggaattactgggcgtaaagcgca 579   
      ||||||||||||||||||||||||#|#|||||||||||||||||||||||||||||||##       
  511 agcagccgcggtaatacggagggtccgagcgttaatcggaattactgggcgtaaagcgtg 570   


  580 cgcaggcggtttgttaagtc-agatgtgaaatccccgggctcaacctgggaact-gcatc 637   
      |||||||||||||||||| | ||||||||||#|||#|||||||||||#|||| | ||||        
  571 cgcaggcggtttgttaag-cgagatgtgaaagccctgggctcaacctaggaa-tcgcat- 627   


  638 t--gatactg-gcaagcttgagtctcgtagaggggggtagaattccaggtgtagcggtga 694   
      |  || |||| #||| ||#||||||#||||||||||||||||||||||||||||||||||       
  628 ttcga-actgaccaa-ctagagtcttgtagaggggggtagaattccaggtgtagcggtga 685   


  695 aatgcgtagagatctggaggaataccggtggcgaaggcggccccctggacgaagactgac 754   
      ||||||||||||||||||||||||||||||||||||||||||||||||||#|||||||||       
  686 aatgcgtagagatctggaggaataccggtggcgaaggcggccccctggacaaagactgac 745   


  755 gctcaggtg--cgaaagcgtggggagcaaacaggattagataccctggtagtccacgccg 812   
      |||||  ||  |||||||||||||||||||||||||||||||||||||||||||||||||       
  746 gctca--tgcacgaaagcgtggggagcaaacaggattagataccctggtagtccacgccg 803   


  813 taaacgatgtcgacttggaggtt--gtgcccttgaggc-gt-ggct-tccggagctaacg 867   
      |||||||||||#|||#||| |||  ||| #||||| #| #| |||| ||  #||||||||       
  804 taaacgatgtctactcgga-gtttggtg-tcttga-acactgggctctc--aagctaacg 858   


  868 cgttaagtcgaccgcctggggagtacggccgcaaggttaaaactcaaatgaattgacggg 927   
      |#||||||#|||||||||||||||||||||||||||||||||||||||||||||||||||       
  859 cattaagtagaccgcctggggagtacggccgcaaggttaaaactcaaatgaattgacggg 918   


  928 ggcccgcacaagcggtggagcatgtggtttaattcgatgcaacgcgaagaaccttacctg 987   
      |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||#       
  919 ggcccgcacaagcggtggagcatgtggtttaattcgatgcaacgcgaagaaccttaccta 978   


  988 gtcttgacatccacaga--actttccagagatg-gattggtgccttcgggaactgtgaga 1044  
      #|||||||||||||#||  ||  |#|||||||| |#|| ||||||||||||||#||||||       
  979 ctcttgacatccacggaagac--tgcagagatgcggtt-gtgccttcgggaaccgtgaga 1035  


 1045 caggtgctgcatggctgtcgtcagctcgtgttgtgaaatgttgggttaagtcccgcaacg 1104  
      ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       
 1036 caggtgctgcatggctgtcgtcagctcgtgttgtgaaatgttgggttaagtcccgcaacg 1095  


 1105 agcgcaacccttat-ctt-ttgttgccagc-ggt-ccggccgggaactcaaaggagactg 1160  
      ||||||||||#||| ||| |  |||||||| #|| ##|| #||||||||#|#||||||||       
 1096 agcgcaacccctatccttat--ttgccagcacgtaatgg-tgggaactctagggagactg 1152  


 1161 ccagtgataaactggaggaaggtggggatgacgtcaagtcatcatggcccttacgaccag 1220  
      ||#|||||||||#|||||||||||||||#|||||||||||||||||||||||||||##||       
 1153 ccggtgataaaccggaggaaggtggggacgacgtcaagtcatcatggcccttacgagtag 1212  


 1221 ggctacacacgtgctacaatggcgca-tacaaagag-------aagcgacctcgcgagag 1272  
      |||||||||||||||||||||||| | |||  ||||       ||||     |||||| |       
 1213 ggctacacacgtgctacaatggcg-agtac--agagggttgcaaagc-----cgcgag-g 1263  


 1273 -caagcggacctcataaag-tgcgtcgtagtccggattggagtctgcaactcgactccat 1330  
       ##|||##|#||||#|||| | ||||||||||||||||||||||||||||||||||||||       
 1264 tggagctaatctcacaaagct-cgtcgtagtccggattggagtctgcaactcgactccat 1322  


 1331 gaagtcggaatcgctagtaatcgtggatcagaatgccacggtgaatacgttcccgggcct 1390  
      ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       
 1323 gaagtcggaatcgctagtaatcgtggatcagaatgccacggtgaatacgttcccgggcct 1382  


 1391 tgtacacaccgcccgtcacaccatgggagtgggttgcaaaagaagtaggtagcttaacct 1450  
      |||||||||||||||||||||||||||||||||#||||||||||||#|||||||||||||       
 1383 tgtacacaccgcccgtcacaccatgggagtgggctgcaaaagaagtgggtagcttaacct 1442  


 1451 tcgggagggcgcttaccactttgtgattcatgactggggtgaagtcgtaacaaggtaacc 1510  
      |||||#|||||||#|||||||||||#|||||||||||||||||||||||||||||||#||       
 1443 tcgggggggcgctcaccactttgtggttcatgactggggtgaagtcgtaacaaggtagcc 1502  


 1511 gtaggggaacctgcggttggatcacctcctta 1542  
      #||||||||||||#||#||||||||||            
 1503 ctaggggaacctggggctggatcacct 1529

Transforming TOP 10 with the light sensor biobrick

We attempted to transform TOP 10 E. coli with the light sensor biobrick (to make P11). No colonies were visible the next morning. This is perhaps because the DNA turned pink after being punched out of the notebook.

Friday: June 20, 2008

Results from Thursday 6/19 Transformations

• Shewie - no growth
• E. coli
  • P3 lawn
  • P4 lawn
  • P5 no growth
  • P6 no growth

Meeting with Orianna Bretschger

General

• Transformation protocol (not via conjugation)
  • Diane Newman –ask for protocol
  • Chemical wont work
  • Electroporation probably way to go
• Plasmids that can be replicated (origins)
  • Check paper for the plasmids and get them
• Promoters that work (inducible, etc)
  • LacZ
  • Any promoters that we know DON’T work?
• Can mtr genes be regulated (eg lacZ)?

Knocking out EnvZ and/or OmpR (together a bit over 2kbp)

• Homologous recombination- time frame, ease
• Cre-lox- which one is easier?
  • Get protocol from Orianna
  • Multiple stable knockouts
  • 3 week method
• effects of removing endogenous envR and ompR
• Has had good track record of E. coli and Shewie exchanging plasmids

MFC

• suggestions on how to grow Shewie anaerobically
  • Lactate
  • Fumerate
  • Ioscitrate
  • Manganese oxide
  • Nitrogen co2 headspace
  • LB broth aerobically then transfer to anaerobically
  • GFP wont work anaerobically?
• ask about colorimetric assay used to detect electrical output; differences between different electron acceptors that we could use and what would be an optimal system for us to use (ie. manganese vs iron(slower) vs some other detection system, like fumarate?)
• protocol for colorimetric assay
• minimum surface area required to detect current over noise
  • graphite paper with lower surface area
  • micro mFC’s
  • should be able to pick something up with relatively small surface area
  • cathode size > anode size so cathode isn’t limiting
  • www.fuelcellstore.com
  • air cathode?
    • Great in chemical fuel cell
• time to produce current after anaerobic
  • almost immediate response
• suggestions for shewanella sensing electric current(light, heat, magnetism)
  • Turning electrical signal off?
    • Flush chamber with oxygen
    • Time frame: minutes?
  • Potential:
    • 0.4 volts Cathode: 0.4 V
  • Invert cathode/anode to turn off Shewie? Oxygen output at anode.
    • Colorimetric oxygen assay
    • Promoters that respond to oxygen environment?

Widgetry

• may be easier to make individual wells/MFC’s and arrange them than to create an actual widget
• Keithley multi-model 2700 20-channel
• Trigger mechanisms available
• DigiKey Potentiometer
• Minimize exposure of wire to prevent interference from corrosion
  • Cover with graphite/epoxy?
  • Titanium wire? No insulator but cover with epoxy?

Contact
Orianna Bretschger: bretschg@usc.edu

Diane Newman: dkn@gps.caltech.edu

Things we have

• Silver epoxy
• Graphite sheet
• Nafion
• Titanium wire
• Platinum coated sheet
• Polycarbonate/polypropylene stock
• Silicon rubber sheets for gaskets
• Pierce G-12 mills?

Transformed S1 via Electroporation

We used the electroporation protocol as noted in General Protocols with the following volumes of vector added:

• P1 (J23113 low) - 2uL
• P2 (J23150 med) - 2uL
• P3 (J23151 high) - 2uL
• P12 (pET Duet-1) - 5uL
• P13 (pCDF Duet) - 1uL
• P14 (pCOLA Duet) - 1uL

Put on the following plates at 30 degrees C over the weekend:

• P1 (J23113 low) - Kan
• P2 (J23150 med) - Kan
• P3 (J23151 high) - Kan
• P12 (pET Duet-1) - Amp
• P13 (pCDF Duet) - Sm
• P14 (pCOLA Duet) - Kan

Transformation of plasmids 11 and 15-20

Chemically competent E. coli DH5a were transformed with plasmids 15-20. Additionally, p11 was repeated.

• We noticed that after punching out the holes from the notebook, the DNA usually turned purple. The DNA that remained yellow turned purple after adding EB buffer. The protocol in the notebook recommends heating the EB buffer before use, but we did not do this. Instead, we incubated the DNA and EB buffer for 20 minutes at 42 °C (instead of at room temperature).
• Additionally, due to time constraints, we only incubated the DNA and bacteria in SOC medium for 1 hour.

Widget

Materials purchased

From McMaster-Carr

Qty.	Part
1	Titanium Grade 2 Wire .046" Diamater, 1/8-lb Coil, 38' Coil
1 ft	Polycarbonate Round Tube 3" OD, 2-5/8" ID, Clear
1 ft	Polycarbonate Square Tube 1"
1 ft	Polycarbonate Square Tube 2" OD
1 ft	Polycarbonate Round Tube 2" OD, 1-7/8" ID, Clear
2 (pack of 10)	Plastic Quick-Turn(Luer Lock) Coupling Nylon, Female X Male Thread, 1/4"-28 Unf Thread
2 (pack of 10)	Plastic Quick-Turn(Luer Lock) Coupling Nylon, Male X Barb, for 3/16" Tube ID
1	Military Grade Pipe Thread Sealant Tape Premium, 43' Lenght X 1/2" Width, Light Green
1	Military Grade Pipe Thread Sealant Tape Premium, 43' Lenght X 1/4" Width, Light Orange

From FuelCellStore

Qty.	Part
1 10x10cm	E-TEK ELAT™ GDE LT120EW: Low Temperature E-TEK ELAT™ GDE microporous layer including Pt electrode on woven web, thin configuration

Equipment Purchased

From Keithley

Model No.	Description
2700	Model 2700 DMM, Data Acquisition, Datalogging System w/ 2 Slots
7700	Model 7700 20-Channel, Differential Multiplexer Module w/ Automatic CJC, Screw Terminals, and up to 50MHz Bandwidth (for Models 2700, 2701, and 2750)