IGEM:Harvard/2008/Lab Notebooks/DailyBook/Week5/Chemical and Light

Testing Thermoinducible Lac System

Restreaked Plates of P92-3 in S1 7/21

Restreaked P93 (1:3), P92a, and P93b--all successfully transformed in S1--to detect YFP at 30 and 40 degrees.

Results 7/22

S1 P93 (1:3), P92a, and P93b grown at 30 and 40 degrees failed to demonstrate any difference in YFP expression. Both expressed very low, if any, YFP.

Sequencing Parts, Plasmids, Etc.

Primers for Sequencing Remy's Plasmids and Duet Vectors 7/21

Primer Name	Sequence
P4P13fwd	GGATCTCGACGCTCTCCCTT
P12fwd	ATGCGTCCGGCGTAGAGGA
DuetRev	TGCTAGTTATTGCTCAGCGG

Analytical Digest of Composite Parts 7/22

Digested composite plasmids to verify size.

Plasmid	DNA Added (uL)	10x Buffer 3 (uL)	100x BSA (uL)	XbaI (uL)	PstI (uL)	Water (uL)	Total (uL)	< 1 ug DNA?	Expected Size
S1 P75a 1 (7/22)	7	2.5 uL	0.25 uL	1 uL	1 uL	13.25	25 uL		925bp, 2750bp
S1 P75a 2 (7/22)	5	2.5 uL	0.25 uL	1 uL	1 uL	15.25	25 uL		925bp, 2750bp
S1 P75b 1 (7/22)	7	2.5 uL	0.25 uL	1 uL	1 uL	13.25	25 uL		925bp, 2750bp
S1 P75b 2 (7/22)	4	2.5 uL	0.25 uL	1 uL	1 uL	16.25	25 uL		925bp, 2750bp
E1 P92a 1:1 (7/17)	7	2.5 uL	0.25 uL	1 uL	1 uL	13.25	25 uL		2314bp, 2750bp
E1 P92b 1:1 (7/17)	7	2.5 uL	0.25 uL	1 uL	1 uL	13.25	25 uL		2314bp, 2750bp
E1 P93a 1:1 (7/17)	7	2.5 uL	0.25 uL	1 uL	1 uL	13.25	25 uL		2314bp, 2750bp
E1 P93b 1:1 (7/17)	10	2.5 uL	0.25 uL	1 uL	1 uL	10.25	25 uL		2314bp, 2750bp
E1 P92a PCR (7/18)	15	2.5 uL	0.25 uL	1 uL	1 uL	5.25	25 uL	Yes	2314bp, 2750bp
S1 P93 1:3 1 (7/17)	7	2.5 uL	0.25 uL	1 uL	1 uL	13.25	25 uL		2314bp, 2750bp
S1 P93 1:3 2 (7/17)	7	2.5 uL	0.25 uL	1 uL	1 uL	13.25	25 uL		2314bp, 2750bp
S1 P92a PCR 1 (7/18)	7	2.5 uL	0.25 uL	1 uL	1 uL	13.25	25 uL		2314bp, 2750bp
S1 P92a PCR 2 (7/18)	7	2.5 uL	0.25 uL	1 uL	1 uL	13.25	25 uL		2314bp, 2750bp
S1 P93b PCR 1 (7/18)	4	2.5 uL	0.25 uL	1 uL	1 uL	16.25	25 uL		2314bp, 2750bp
S1 P93b PCR 2 (7/18)	7	2.5 uL	0.25 uL	1 uL	1 uL	13.25	25 uL		2314bp, 2750bp
E1 P58b 1 (7/18)	7	2.5 uL	0.25 uL	1 uL	1 uL	13.25	25 uL		937bp, 2750bp
E1 P58b 2 (7/18)	10	2.5 uL	0.25 uL	1 uL	1 uL	10.25	25 uL		937bp, 2750bp
S1 P58b A (7/15)	10	2.5 uL	0.25 uL	1 uL	1 uL	10.25	25 uL	Yes	937bp, 2750bp
S1 P58b B (7/15)	10	2.5 uL	0.25 uL	1 uL	1 uL	10.25	25 uL	Yes	937bp, 2750bp
S1 P59 (7/9)	10	2.5 uL	0.25 uL	1 uL	1 uL	10.25	25 uL	Yes	1122bp, 2750bp
S1 P59b 1 (7/22)	10	2.5 uL	0.25 uL	1 uL	1 uL	10.25	25 uL	Yes	1122bp, 2750bp
S1 P59b 2 (7/18)	3	2.5 uL	0.25 uL	1 uL	1 uL	17.25	25 uL		1122bp, 2750bp

'	'
	1- 1kb ladder 2- S1 p75a 1 3- S1 p75a 2 4- S1 p75b 1 5- S1 p75b 2 6- E1 P92b 1:1 7- E1 P92a 1:1 8- E1 P93a 1:1 9- E1 P93b 1:1 10- E1 P92a PCR 11- S1 P93 1:3 1 12- S1 P93 1:3 2

Making Thermoinducible cI Lambda System

Primers for Taking Out cI857 from PGW7 7/21

Primer Name	Sequence
CI857_RBSfwd	Atcgagaattcgcggccgcttctagagaaagaggagaaaatgagcacaaaaaagaaac
CI857_RBSrev	Atcgatactagtagcggccgctgcagtcagccaaacgtctcttcag
CI857_BIGfwd	Atcgagaattcgcggccgcttctagagtcatgacattaacctataaa
CI857_BIGrev	atcgatactagtagcggccgctgcagcagccagcagagaattaagg

Minipreps of Transformed Parts in S1 7/22

Also includes transformed P28 and the thermoinducible lac system.

Plasmid Name	ng/uL	A260	260/280	260/230	Constant
S1 P75a 1	156.2	3.124	1.99	2.27	50
S1 P75a 2	203.24	4.065	2.04	2.23	50
S1 P75b 1	177.41	3.548	2.02	2.16	50
S1 P75b 2	258.85	5.177	2.01	2.3	50
S1 P28a 1	155.42	3.108	2.03	2.27	50
S1 P28a 2	239.51	4.79	2.06	2.26	50
S1 P28a 3	204.5	4.09	2.01	2.24	50
S1 P93 1:3 1	175.27	3.505	2.07	2.32	50
S1 P93 1:3 2	166.9	3.338	2.12	2.38	50
S1 P92a PCR 1	152.58	3.052	2.02	2.28	50
S1 P92a PCR 2	157.59	3.152	2.02	2.22	50
S1 P93b PCR 1	291.87	5.837	2.13	2.23	50
S1 P93b PCR 2	152	3.04	2.07	2.21	50

Adding Terminator Before pLambda GFP

Digestion of Terminator (P64) and pLambda GFP 7/22

'	P75a 1 (vector)	P75b 1 (vector)	P64a 07 (insert)
DNA	10 uL	10 uL	10 uL
100x BSA	0.25 uL	0.25 uL	0.25 uL
10x Buffer	2.5 uL EcoRI buffer	2.5 uL EcoRI buffer	2.5 uL EcoRI buffer
Enzyme 1	1 uL EcoRI	1 uL EcoRI	1 uL EcoRI
Enzyme 2	1 uL XbaI	1 uL XbaI	1 uL SpeI
Water	5.25 uL	5.25 uL	5.25 uL
Total	25 uL	25 uL	25 uL

Housekeeping

Making Competent Cells 7/22

Made ~600 100uL (some were 200 uL, indicated by green dot on top) aliquots from 1L of culture. Done as per Jason's lab's protocol.

PCR

mtrB

7/22: gradient + new R primer

Rx mix (split into 12 samples): 180μL PCR supermix, 4μL mtrB-ApaLI-F primer (20μM), 4μL mtrB-KpnI-R-new (20μM), pipet tip touch of mtrB BB from gel purification, 12μL water Rx: 5min @ 94°C → 35x[45s @ 94°C → 45s @ {52-58 gradient}°C → 2m38s @72°C] → 5min @ 72°C → ∞ @ 4°C

No bands on gel from any of the conditions.

Rx mix (split into 12 samples): 180μL PCR supermix, 4μL mtrB-ApaLI-F primer (20μM), 4μL mtrB-KpnI-R-new (20μM), pipet tip touch of WT S. oneidensis MR-1, 12μL water Rx: 10min @ 94°C → 40x[45s @ 94°C → 45s @ {44-51 gradient}°C → 2m45s @72°C] → 5min @ 72°C → ∞ @ 4°C

7/23: gel

All the temperatures seem to have worked (51 was not loaded due to # lanes on gel). Expected product size ~2.1kb.

P51, 52, 17 MIT

17, 52:
Rx mix (split into 4 samples): 180μL Platinum PCR supermix, 4μL BBpfx primer (20μM), 4μL BBsfx primer (20μM), 4μL miniprepped DNA, 8μL water
51:
Rx mix (split into 4 samples): 100μL AmpliTaq Gold Master Mix, 4μL BBpfx primer (20μM), 4μL BBsfx primer (20μM), 4μL miniprepped DNA, 88μL water

Rx: 5min @ 94°C → 35x[45s @ 94°C → 45s @ {52.7, 53.6, 54.6, 55.5}°C → 1m25s @72°C] → 5min @ 72°C → ∞ @ 4°C

Results

1-4: P17 5-8: P51 9-11: P52 12: 1KB plus ladder

RE digests 07/22

Gel 1

Lane 1: 1 kb plus ladder

Lane 2: CDF PCR cut XP (~900)

Lane 3: CDF PCR uncut (~900)

Lane 4: P1A cut XP (2750)

Lane 5: P1A uncut (3669)

Lane 6: P17 cut EX (5327)

Lane 7: P17 uncut (5327)

Lane 8: P48 cut XP (769)

Lane 9: P48 uncut (3477)

Gel 2

Lane 1: 1 kb plus ladder

Lane 2: P49B cut XP (943)

Lane 3: P49B uncut (3651)

Lane 4: P51 cut EX (5795)

Lane 5: P51 uncut (5795)

Lane 6: P52 cut EX (5412)

Lane 7: P52 uncut (5412)

Lane 8: P63 cut EX (3284)

Lane 9: P63 uncut (3284)

Gel 3

Lane 1: 1 kb plus ladder

Lane 2: P97A cut EX (2091)

Lane 3: P97A uncut (2091)

Lane 4: P97B cut EX (2091)

Lane 5: P97B uncut (2091)

Ligations 07/22

• We ligated P1A (vector) to CDF. We used three different ratios of vector to insert for the ligation: 2/6, 1/5, 1/7.
• Attempted to ligate p40 cut with SP (w/ RBS) to mtrB cut with XP. Thus far, the ligation has not worked.

Recombination Update 07/22

• Thus far, none of the attempts to extract flanking regions from the genomic DNA have worked. We are troubleshooting this now and will run positive controls with known DNA samples to check the efficiency of our Phusion Polimerase.

07/23 Ligations/Transformations

• Ligated p40 cut SP with mtrB cut XP at 2:3, 1:2, 1:4, 1:5, 1:6, positive control is uncut p40, negative control (to test Amp plates) is p29 (Kan)

RE digests 07/23

Gel 1

Lane 1: 1 kb plus ladder

Lane 2: P97A cut SP (2091)

Lane 3: P97A uncut

Lane 4: P97B cut SP (2091)

Lane 5: P97B uncut

Lane 6: P51 cut EX (5795)

Lane 7: P51 uncut

Lane 8: P52 cut EX (5412)

Lane 9: P52 uncut

Lane 10: P90ζ cut SP (~3600)

Lane 11: P90ζ uncut

Lane 12: P90ε cut SP (~3600)

Lane 13: P90ε uncut

Lane 14: mtr B (not BioBrick) uncut (2100)

Gel 2

Lane 1: 1 kb plus ladder

Lane 2: P17 cut EX (5327)

Lane 3: P17 uncut

Lane 4: S1P3A B cut XP (2750)

Lane 5: S1P3A B uncut

Lane 6: S1P3A C cut XP (2750)

Lane 7: S1P3A C uncut

Lane 8: P3A cut XP (2750)

Lane 9: P3A uncut

Lane 10: P3B cut XP (2750)

Lane 11: P3B uncut

Lane 12: mtrB BB cut XP (2100)

Lane 13: mtrB BB uncut

Ligations 07/23

We ligated

• P97 and mtrB BB
• P3 and CDF

We used three different ratios of insert to vector for the ligation: 6/2, 5/1, 7/1.

We used 5 μL of the ligation to transform TOP10 cells and 5 μL to transform the new DH5α cells. We also used 1 μL and 3 μL to transform DH5α. We used pUC19 (1 μL) as a positive control to test the efficacy of the new DH5α cells.

We used Jason's protocol to transform the new DH5α cells:

• Thaw cells by resting tubes on ice
• Then add DNA and mix by swirling with the pipette tip
• Incubate the cells with DNA in ice for 10min
• Heatshock at 42C for 2min
• Then incubate in ice for 2-5min
• Add 500-700ml LB (or SOC) and incubate + 250rpm shaking for 1hr at 37C
• Plate

Results

Strain	DNA	Vector:Insert (μL)	Amount transformed (μL)	Plate	# colonies
E1	pUC19	n/a	1	AMP	40
E1	-	n/a	-	CARB	0
E2	P97+ mtrB BioBrick	2:6	5	CARB	136
E2	P97+ mtrB BioBrick	1:5	5	CARB	48
E2	P97+ mtrB BioBrick	1:7	5	CARB	64
E1	P97+ mtrB BioBrick	1:7	1	CARB	0
E1	P97+ mtrB BioBrick	1:7	3	CARB	0
E1	P97+ mtrB BioBrick	1:7	5	CARB	4
E1	P97+ mtrB BioBrick	1:5	1	CARB	0
E1	P97+ mtrB BioBrick	1:5	1	CARB	0
E1	P97+ mtrB BioBrick	1:5	1	CARB	0
E1	P97+ mtrB BioBrick	2:6	1	CARB	1
E1	P97+ mtrB BioBrick	2:6	1	CARB	7
E1	P97+ mtrB BioBrick	2:6	1	CARB	9
E2	P3+CDF	2:6	5	KAN	7
E2	P3+CDF	1:5	5	KAN	56
E2	P3+CDF	1:7	5	KAN	5
E1	P3+CDF	1:7	1	KAN	0
E1	P3+CDF	1:7	3	KAN	2
E1	P3+CDF	1:7	5	KAN	0
E1	P3+CDF	1:5	1	KAN	0
E1	P3+CDF	1:5	3	KAN	0
E1	P3+CDF	1:5	5	KAN	0
E1	P3+CDF	2:6	1	KAN	0
E1	P3+CDF	2:6	3	KAN	1
E1	P3+CDF	2:6	5	KAN	0

• Try 45s heat shock and SOC for new cells
• Try 3 or 5 μL transformations
• New Carb plates seem fine

Ligations 07/24

We ligated p75a w/ p63 w/ a ratio of 4ul p63:1ul p75a

Transformed into new dh5α competent cells w/ volumes of 1, 3, and 5uL, using Jason's new protocol. As a control transformed 1uL of pUC19.