IGEM:Harvard/2008/Lab Notebooks/DailyBook/Week5/Chemical and Light: Difference between revisions
Line 285: | Line 285: | ||
*Ligated p40 cut SP with mtrB cut XP at 2:3, 1:2, 1:4, 1:5, 1:6, positive control is uncut p40, negative control (to test Amp plates) is p29 (Kan) | *Ligated p40 cut SP with mtrB cut XP at 2:3, 1:2, 1:4, 1:5, 1:6, positive control is uncut p40, negative control (to test Amp plates) is p29 (Kan) | ||
=RE digests 07/23 = | =Cool RE digests 07/23 = | ||
'''Gel 1''' | '''Gel 1''' | ||
Revision as of 14:44, 24 July 2008
Testing Thermoinducible Lac System
Restreaked Plates of P92-3 in S1 7/21
Restreaked P93 (1:3), P92a, and P93b--all successfully transformed in S1--to detect YFP at 30 and 40 degrees.
Results 7/22
S1 P93 (1:3), P92a, and P93b grown at 30 and 40 degrees failed to demonstrate any difference in YFP expression. Both expressed very low, if any, YFP.
Sequencing Parts, Plasmids, Etc.
Primers for Sequencing Remy's Plasmids and Duet Vectors 7/21
Primer Name | Sequence |
P4P13fwd | GGATCTCGACGCTCTCCCTT |
P12fwd | ATGCGTCCGGCGTAGAGGA |
DuetRev | TGCTAGTTATTGCTCAGCGG |
Analytical Digest of Composite Parts 7/22
Digested composite plasmids to verify size.
Plasmid | DNA Added (uL) | 10x Buffer 3 (uL) | 100x BSA (uL) | XbaI (uL) | PstI (uL) | Water (uL) | Total (uL) | < 1 ug DNA? | Expected Size |
S1 P75a 1 (7/22) | 7 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 13.25 | 25 uL | 925bp, 2750bp | |
S1 P75a 2 (7/22) | 5 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 15.25 | 25 uL | 925bp, 2750bp | |
S1 P75b 1 (7/22) | 7 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 13.25 | 25 uL | 925bp, 2750bp | |
S1 P75b 2 (7/22) | 4 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 16.25 | 25 uL | 925bp, 2750bp | |
E1 P92a 1:1 (7/17) | 7 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 13.25 | 25 uL | 2314bp, 2750bp | |
E1 P92b 1:1 (7/17) | 7 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 13.25 | 25 uL | 2314bp, 2750bp | |
E1 P93a 1:1 (7/17) | 7 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 13.25 | 25 uL | 2314bp, 2750bp | |
E1 P93b 1:1 (7/17) | 10 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 10.25 | 25 uL | 2314bp, 2750bp | |
E1 P92a PCR (7/18) | 15 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 5.25 | 25 uL | Yes | 2314bp, 2750bp |
S1 P93 1:3 1 (7/17) | 7 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 13.25 | 25 uL | 2314bp, 2750bp | |
S1 P93 1:3 2 (7/17) | 7 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 13.25 | 25 uL | 2314bp, 2750bp | |
S1 P92a PCR 1 (7/18) | 7 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 13.25 | 25 uL | 2314bp, 2750bp | |
S1 P92a PCR 2 (7/18) | 7 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 13.25 | 25 uL | 2314bp, 2750bp | |
S1 P93b PCR 1 (7/18) | 4 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 16.25 | 25 uL | 2314bp, 2750bp | |
S1 P93b PCR 2 (7/18) | 7 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 13.25 | 25 uL | 2314bp, 2750bp | |
E1 P58b 1 (7/18) | 7 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 13.25 | 25 uL | 937bp, 2750bp | |
E1 P58b 2 (7/18) | 10 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 10.25 | 25 uL | 937bp, 2750bp | |
S1 P58b A (7/15) | 10 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 10.25 | 25 uL | Yes | 937bp, 2750bp |
S1 P58b B (7/15) | 10 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 10.25 | 25 uL | Yes | 937bp, 2750bp |
S1 P59 (7/9) | 10 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 10.25 | 25 uL | Yes | 1122bp, 2750bp |
S1 P59b 1 (7/22) | 10 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 10.25 | 25 uL | Yes | 1122bp, 2750bp |
S1 P59b 2 (7/18) | 3 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 17.25 | 25 uL | 1122bp, 2750bp |
' | ' |
1- 1kb ladder
2- S1 p75a 1 3- S1 p75a 2 4- S1 p75b 1 5- S1 p75b 2 6- E1 P92b 1:1 7- E1 P92a 1:1 8- E1 P93a 1:1 9- E1 P93b 1:1 10- E1 P92a PCR 11- S1 P93 1:3 1 12- S1 P93 1:3 2 |
Making Thermoinducible cI Lambda System
Primers for Taking Out cI857 from PGW7 7/21
Primer Name | Sequence |
CI857_RBSfwd | Atcgagaattcgcggccgcttctagagaaagaggagaaaatgagcacaaaaaagaaac |
CI857_RBSrev | Atcgatactagtagcggccgctgcagtcagccaaacgtctcttcag |
CI857_BIGfwd | Atcgagaattcgcggccgcttctagagtcatgacattaacctataaa |
CI857_BIGrev | atcgatactagtagcggccgctgcagcagccagcagagaattaagg |
Minipreps of Transformed Parts in S1 7/22
Also includes transformed P28 and the thermoinducible lac system.
Plasmid Name | ng/uL | A260 | 260/280 | 260/230 | Constant |
S1 P75a 1 | 156.2 | 3.124 | 1.99 | 2.27 | 50 |
S1 P75a 2 | 203.24 | 4.065 | 2.04 | 2.23 | 50 |
S1 P75b 1 | 177.41 | 3.548 | 2.02 | 2.16 | 50 |
S1 P75b 2 | 258.85 | 5.177 | 2.01 | 2.3 | 50 |
S1 P28a 1 | 155.42 | 3.108 | 2.03 | 2.27 | 50 |
S1 P28a 2 | 239.51 | 4.79 | 2.06 | 2.26 | 50 |
S1 P28a 3 | 204.5 | 4.09 | 2.01 | 2.24 | 50 |
S1 P93 1:3 1 | 175.27 | 3.505 | 2.07 | 2.32 | 50 |
S1 P93 1:3 2 | 166.9 | 3.338 | 2.12 | 2.38 | 50 |
S1 P92a PCR 1 | 152.58 | 3.052 | 2.02 | 2.28 | 50 |
S1 P92a PCR 2 | 157.59 | 3.152 | 2.02 | 2.22 | 50 |
S1 P93b PCR 1 | 291.87 | 5.837 | 2.13 | 2.23 | 50 |
S1 P93b PCR 2 | 152 | 3.04 | 2.07 | 2.21 | 50 |
Adding Terminator Before pLambda GFP
Digestion of Terminator (P64) and pLambda GFP 7/22
' | P75a 1 (vector) | P75b 1 (vector) | P64a 07 (insert) |
DNA | 10 uL | 10 uL | 10 uL |
100x BSA | 0.25 uL | 0.25 uL | 0.25 uL |
10x Buffer | 2.5 uL EcoRI buffer | 2.5 uL EcoRI buffer | 2.5 uL EcoRI buffer |
Enzyme 1 | 1 uL EcoRI | 1 uL EcoRI | 1 uL EcoRI |
Enzyme 2 | 1 uL XbaI | 1 uL XbaI | 1 uL SpeI |
Water | 5.25 uL | 5.25 uL | 5.25 uL |
Total | 25 uL | 25 uL | 25 uL |
Housekeeping
Making Competent Cells 7/22
Made ~600 100uL (some were 200 uL, indicated by green dot on top) aliquots from 1L of culture. Done as per Jason's lab's protocol.
Cool PCR
mtrB
7/22: gradient + new R primer
Rx mix (split into 12 samples): 180μL PCR supermix, 4μL mtrB-ApaLI-F primer (20μM), 4μL mtrB-KpnI-R-new (20μM), pipet tip touch of mtrB BB from gel purification, 12μL water Rx: 5min @ 94°C → 35x[45s @ 94°C → 45s @ {52-58 gradient}°C → 2m38s @72°C] → 5min @ 72°C → ∞ @ 4°C
No bands on gel from any of the conditions.
Rx mix (split into 12 samples): 180μL PCR supermix, 4μL mtrB-ApaLI-F primer (20μM), 4μL mtrB-KpnI-R-new (20μM), pipet tip touch of WT S. oneidensis MR-1, 12μL water Rx: 10min @ 94°C → 40x[45s @ 94°C → 45s @ {44-51 gradient}°C → 2m45s @72°C] → 5min @ 72°C → ∞ @ 4°C
7/23: gel
All the temperatures seem to have worked (51 was not loaded due to # lanes on gel). Expected product size ~2.1kb.
P51, 52, 17 MIT
17, 52:
Rx mix (split into 4 samples): 180μL Platinum PCR supermix, 4μL BBpfx primer (20μM), 4μL BBsfx primer (20μM), 4μL miniprepped DNA, 8μL water
51:
Rx mix (split into 4 samples): 100μL AmpliTaq Gold Master Mix, 4μL BBpfx primer (20μM), 4μL BBsfx primer (20μM), 4μL miniprepped DNA, 88μL water
Rx: 5min @ 94°C → 35x[45s @ 94°C → 45s @ {52.7, 53.6, 54.6, 55.5}°C → 1m25s @72°C] → 5min @ 72°C → ∞ @ 4°C
Results
1-4: P17 5-8: P51 9-11: P52 12: 1KB plus ladder
Cool RE digests 07/22
Gel 1
Lane 1: 1 kb plus ladder
Lane 2: CDF PCR cut XP (~900)
Lane 3: CDF PCR uncut (~900)
Lane 4: P1A cut XP (2750)
Lane 5: P1A uncut (3669)
Lane 6: P17 cut EX (5327)
Lane 7: P17 uncut (5327)
Lane 8: P48 cut XP (769)
Lane 9: P48 uncut (3477)
Gel 2
Lane 1: 1 kb plus ladder
Lane 2: P49B cut XP (943)
Lane 3: P49B uncut (3651)
Lane 4: P51 cut EX (5795)
Lane 5: P51 uncut (5795)
Lane 6: P52 cut EX (5412)
Lane 7: P52 uncut (5412)
Lane 8: P63 cut EX (3284)
Lane 9: P63 uncut (3284)
Gel 3
Lane 1: 1 kb plus ladder
Lane 2: P97A cut EX (2091)
Lane 3: P97A uncut (2091)
Lane 4: P97B cut EX (2091)
Lane 5: P97B uncut (2091)
Cool Ligations 07/22
- We ligated P1A (vector) to CDF. We used three different ratios of vector to insert for the ligation: 2/6, 1/5, 1/7.
- Attempted to ligate p40 cut with SP (w/ RBS) to mtrB cut with XP. Thus far, the ligation has not worked.
Recombination Update 07/22
- Thus far, none of the attempts to extract flanking regions from the genomic DNA have worked. We are troubleshooting this now and will run positive controls with known DNA samples to check the efficiency of our Phusion Polimerase.
07/23 Ligations/Transformations
- Ligated p40 cut SP with mtrB cut XP at 2:3, 1:2, 1:4, 1:5, 1:6, positive control is uncut p40, negative control (to test Amp plates) is p29 (Kan)
Cool RE digests 07/23
Gel 1
Lane 1: 1 kb plus ladder
Lane 2: P97A cut SP (2091)
Lane 3: P97A uncut
Lane 4: P97B cut SP (2091)
Lane 5: P97B uncut
Lane 6: P51 cut EX (5795)
Lane 7: P51 uncut
Lane 8: P52 cut EX (5412)
Lane 9: P52 uncut
Lane 10: P90ζ cut SP (~3600)
Lane 11: P90ζ uncut
Lane 12: P90ε cut SP (~3600)
Lane 13: P90ε uncut
Lane 14: mtr B (not BioBrick) uncut (2100)
Gel 2
Lane 1: 1 kb plus ladder
Lane 2: P17 cut EX (5327)
Lane 3: P17 uncut
Lane 4: S1P3A B cut XP (2750)
Lane 5: S1P3A B uncut
Lane 6: S1P3A C cut XP (2750)
Lane 7: S1P3A C uncut
Lane 8: P3A cut XP (2750)
Lane 9: P3A uncut
Lane 10: P3B cut XP (2750)
Lane 11: P3B uncut
Lane 12: mtrB BB cut XP (2100)
Lane 13: mtrB BB uncut
Ligations 07/23
We ligated
- P97 and mtrB BB
- P3 and CDF
We used three different ratios of insert to vector for the ligation: 6/2, 5/1, 7/1.
We used 5 μL of the ligation to transform TOP10 cells and 5 μL to transform the new DH5α cells. We also used 1 μL and 3 μL to transform DH5α. We used pUC19 (1 μL) as a positive control to test the efficacy of the new DH5α cells.
We used Jason's protocol to transform the new DH5α cells:
- Thaw cells by resting tubes on ice
- Then add DNA and mix by swirling with the pipette tip
- Incubate the cells with DNA in ice for 10min
- Heat shock at 42C for 2min
- Then incubate in ice for 2-5min
- Add 500-700ml LB (or SOC) and incubate + 250rpm shaking for 1hr at 37C
- Plate
Results
Strain | DNA | Vector:Insert (μL) | Amount transformed (μL) | Plate | # colonies |
E1 | pUC19 | n/a | 1 | AMP | 40 |
E1 | - | n/a | - | CARB | 0 |
E2 | P97+ mtrB BioBrick | 2:6 | 5 | CARB | 136 |
E2 | P97+ mtrB BioBrick | 1:5 | 5 | CARB | 48 |
E2 | P97+ mtrB BioBrick | 1:7 | 5 | CARB | 64 |
E1 | P97+ mtrB BioBrick | 1:7 | 1 | CARB | 0 |
E1 | P97+ mtrB BioBrick | 1:7 | 3 | CARB | 0 |
E1 | P97+ mtrB BioBrick | 1:7 | 5 | CARB | 4 |
E1 | P97+ mtrB BioBrick | 1:5 | 1 | CARB | 0 |
E1 | P97+ mtrB BioBrick | 1:5 | 1 | CARB | 0 |
E1 | P97+ mtrB BioBrick | 1:5 | 1 | CARB | 0 |
E1 | P97+ mtrB BioBrick | 2:6 | 1 | CARB | 1 |
E1 | P97+ mtrB BioBrick | 2:6 | 1 | CARB | 7 |
E1 | P97+ mtrB BioBrick | 2:6 | 1 | CARB | 9 |
E2 | P3+CDF | 2:6 | 5 | KAN | 7 |
E2 | P3+CDF | 1:5 | 5 | KAN | 56 |
E2 | P3+CDF | 1:7 | 5 | KAN | 5 |
E1 | P3+CDF | 1:7 | 1 | KAN | 0 |
E1 | P3+CDF | 1:7 | 3 | KAN | 2 |
E1 | P3+CDF | 1:7 | 5 | KAN | 0 |
E1 | P3+CDF | 1:5 | 1 | KAN | 0 |
E1 | P3+CDF | 1:5 | 3 | KAN | 0 |
E1 | P3+CDF | 1:5 | 5 | KAN | 0 |
E1 | P3+CDF | 2:6 | 1 | KAN | 0 |
E1 | P3+CDF | 2:6 | 3 | KAN | 1 |
E1 | P3+CDF | 2:6 | 5 | KAN | 0 |
- Try 45s heat shock and SOC for new cells
- Try 3 or 5 μL transformations
- New Carb plates seem fine
Ligations 07/24
We ligated p75a w/ p63 w/ a ratio of 4ul p63:1ul p75a
Transformed into new dh5α competent cells w/ volumes of 1, 3, and 5uL, using Jason's new protocol. As a control transformed 1uL of pUC19.
RE digests 07/24
Lane 1: 1 kb ladder
Lane 2: P1A uncut (~3600)
Lane 3: P1A cut EP (~3600)
Lane 4: P3A uncut (~3600)
Lane 5: P3A cut EP (~3600)
Lane 6: P17 PCR cut XP (902)
Lane 7: P52 PCR cut XP (987)
Lane 8: P90.4 uncut (~3600)
Lane 9: P90.1 cut SP (~3600)
Lane 10: P90.2 cut SP (~3600)
Lane 11: P90.3 cut SP (~3600)
Lane 12: P90.4 cut SP (~3600)