IGEM:Harvard/2008/Lab Notebooks/DailyBook/Week5/Chemical and Light

Testing Thermoinducible Lac System

Restreaked Plates of P92-3 in S1 7/21

Restreaked P93 (1:3), P92a, and P93b--all successfully transformed in S1--to detect YFP at 30 and 40 degrees.

Results 7/22

S1 P93 (1:3), P92a, and P93b plates grown at 30 and 40 degrees failed to demonstrate any difference in YFP expression. Both expressed very low, if any, YFP.

Sequencing Parts, Plasmids, Etc.

Primers for Sequencing Remy's Plasmids and Duet Vectors 7/21

Primer Name	Sequence
P4P13fwd	GGATCTCGACGCTCTCCCTT
P12fwd	ATGCGTCCGGCGTAGAGGA
DuetRev	TGCTAGTTATTGCTCAGCGG

Analytical Digest of Composite Parts 7/22

Digested composite plasmids to verify size.

Plasmid	DNA Added (uL)	10x Buffer 3 (uL)	100x BSA (uL)	XbaI (uL)	PstI (uL)	Water (uL)	Total (uL)	< 1 ug DNA?	Expected Size
S1 P75a 1 (7/22)	7	2.5 uL	0.25 uL	1 uL	1 uL	13.25	25 uL		925bp, 2750bp
S1 P75a 2 (7/22)	5	2.5 uL	0.25 uL	1 uL	1 uL	15.25	25 uL		925bp, 2750bp
S1 P75b 1 (7/22)	7	2.5 uL	0.25 uL	1 uL	1 uL	13.25	25 uL		925bp, 2750bp
S1 P75b 2 (7/22)	4	2.5 uL	0.25 uL	1 uL	1 uL	16.25	25 uL		925bp, 2750bp
E1 P92a 1:1 (7/17)	7	2.5 uL	0.25 uL	1 uL	1 uL	13.25	25 uL		2314bp, 2750bp
E1 P92b 1:1 (7/17)	7	2.5 uL	0.25 uL	1 uL	1 uL	13.25	25 uL		2314bp, 2750bp
E1 P93a 1:1 (7/17)	7	2.5 uL	0.25 uL	1 uL	1 uL	13.25	25 uL		2314bp, 2750bp
E1 P93b 1:1 (7/17)	10	2.5 uL	0.25 uL	1 uL	1 uL	10.25	25 uL		2314bp, 2750bp
E1 P92a PCR (7/18)	15	2.5 uL	0.25 uL	1 uL	1 uL	5.25	25 uL	Yes	2314bp, 2750bp
S1 P93 1:3 1 (7/17)	7	2.5 uL	0.25 uL	1 uL	1 uL	13.25	25 uL		2314bp, 2750bp
S1 P93 1:3 2 (7/17)	7	2.5 uL	0.25 uL	1 uL	1 uL	13.25	25 uL		2314bp, 2750bp
S1 P92a PCR 1 (7/18)	7	2.5 uL	0.25 uL	1 uL	1 uL	13.25	25 uL		2314bp, 2750bp
S1 P92a PCR 2 (7/18)	7	2.5 uL	0.25 uL	1 uL	1 uL	13.25	25 uL		2314bp, 2750bp
S1 P93b PCR 1 (7/18)	4	2.5 uL	0.25 uL	1 uL	1 uL	16.25	25 uL		2314bp, 2750bp
S1 P93b PCR 2 (7/18)	7	2.5 uL	0.25 uL	1 uL	1 uL	13.25	25 uL		2314bp, 2750bp
E1 P58b 1 (7/18)	7	2.5 uL	0.25 uL	1 uL	1 uL	13.25	25 uL		937bp, 2750bp
E1 P58b 2 (7/18)	10	2.5 uL	0.25 uL	1 uL	1 uL	10.25	25 uL		937bp, 2750bp
S1 P58b A (7/15)	10	2.5 uL	0.25 uL	1 uL	1 uL	10.25	25 uL	Yes	937bp, 2750bp
S1 P58b B (7/15)	10	2.5 uL	0.25 uL	1 uL	1 uL	10.25	25 uL	Yes	937bp, 2750bp
S1 P59 (7/9)	10	2.5 uL	0.25 uL	1 uL	1 uL	10.25	25 uL	Yes	1122bp, 2750bp
S1 P59b 1 (7/22)	10	2.5 uL	0.25 uL	1 uL	1 uL	10.25	25 uL	Yes	1122bp, 2750bp
S1 P59b 2 (7/18)	3	2.5 uL	0.25 uL	1 uL	1 uL	17.25	25 uL		1122bp, 2750bp

Gel Results 7/23

	1% Agarose, visualized using EtBr/UV
	Lane	Sample
	1	1 kB ladder
	2	S1 P75a 1 (7/22)
	3	S1 P75a 2 (7/22)
	4	S1 P75b 1 (7/22)
	5	S1 P75b 2 (7/22)
	6	E1 P92b 1:1 (7/17)
	7	E1 P92a 1:1 (7/17)
	8	E1 P93a 1:1 (7/17)
	9	E1 P93b 1:1 (7/17)
	10	E1 P92a PCR (7/18)
	11	S1 P93 1:3 1 (7/17)
	12	S1 P93 1:3 2 (7/17)

	1% Agarose, visualized using EtBr/UV
	Lane	Sample
	1	1 kB ladder
	2	S1 P92a PCR 1 (7/18)
	3	S1 P92a PCR 2 (7/18)
	4	S1 P93b PCR 1 (7/18)
	5	S1 P93b PCR 2 (7/18)
	6	E1 P58b 1 (7/18)
	7	E1 P58b 2 (7/18)
	8	S1 P58b A (7/15)
	9	S1 P58b B (7/15)
	10	S1 P59 (7/9)
	11	S1 P59b 1 (7/22)
	12	S1 P59b 2 (7/18)

Making Thermoinducible cI Lambda System

Primers for Taking Out cI857 from PGW7 7/21

Primer Name	Sequence
CI857_RBSfwd	Atcgagaattcgcggccgcttctagagaaagaggagaaaatgagcacaaaaaagaaac
CI857_RBSrev	Atcgatactagtagcggccgctgcagtcagccaaacgtctcttcag
CI857_BIGfwd	Atcgagaattcgcggccgcttctagagtcatgacattaacctataaa
CI857_BIGrev	atcgatactagtagcggccgctgcagcagccagcagagaattaagg

Minipreps of Transformed Parts in S1 7/22

Also includes transformed P28 and the thermoinducible lac system.

Plasmid Name	ng/uL	A260	260/280	260/230	Constant
S1 P75a 1	156.2	3.124	1.99	2.27	50
S1 P75a 2	203.24	4.065	2.04	2.23	50
S1 P75b 1	177.41	3.548	2.02	2.16	50
S1 P75b 2	258.85	5.177	2.01	2.3	50
S1 P28a 1	155.42	3.108	2.03	2.27	50
S1 P28a 2	239.51	4.79	2.06	2.26	50
S1 P28a 3	204.5	4.09	2.01	2.24	50
S1 P93 1:3 1	175.27	3.505	2.07	2.32	50
S1 P93 1:3 2	166.9	3.338	2.12	2.38	50
S1 P92a PCR 1	152.58	3.052	2.02	2.28	50
S1 P92a PCR 2	157.59	3.152	2.02	2.22	50
S1 P93b PCR 1	291.87	5.837	2.13	2.23	50
S1 P93b PCR 2	152	3.04	2.07	2.21	50

Adding Terminator Before pLambda GFP

Digestion of Terminator (P64) and pLambda GFP 7/22

'	P75a 1 (vector)	P75b 1 (vector)	P64a 07 (insert)
DNA	10 uL	10 uL	10 uL
100x BSA	0.25 uL	0.25 uL	0.25 uL
10x Buffer	2.5 uL EcoRI buffer	2.5 uL EcoRI buffer	2.5 uL EcoRI buffer
Enzyme 1	1 uL EcoRI	1 uL EcoRI	1 uL EcoRI
Enzyme 2	1 uL XbaI	1 uL XbaI	1 uL SpeI
Water	5.25 uL	5.25 uL	5.25 uL
Total	25 uL	25 uL	25 uL

Digestion Gel Results 7/23

	1% Agarose, visualized using EtBr/UV
	Lane	Sample
	1	1kB Ladder
	3	S1 P75a (2750/925)
	4	100bp Ladder
	5	S1 P75b 1 (2750/925)
	7	P64a 07 (~3kb/129bp)
	9	1kB Ladder

Housekeeping

Making Competent Cells 7/22

Made ~600 100uL (some were 200 uL, indicated by green dot on top) aliquots from 1L of culture. Done as per Jason's lab's protocol.

PCR

mtrB

7/22: gradient + new R primer

Rx mix (split into 12 samples): 180μL PCR supermix, 4μL mtrB-ApaLI-F primer (20μM), 4μL mtrB-KpnI-R-new (20μM), pipet tip touch of mtrB BB from gel purification, 12μL water Rx: 5min @ 94°C → 35x[45s @ 94°C → 45s @ {52-58 gradient}°C → 2m38s @72°C] → 5min @ 72°C → ∞ @ 4°C

No bands on gel from any of the conditions.

Lower gradient

Rx mix (split into 12 samples): 180μL PCR supermix, 4μL mtrB-ApaLI-F primer (20μM), 4μL mtrB-KpnI-R-new (20μM), pipet tip touch of WT S. oneidensis MR-1, 12μL water Rx: 10min @ 94°C → 40x[45s @ 94°C → 45s @ {44-51 gradient}°C → 2m45s @72°C] → 5min @ 72°C → ∞ @ 4°C

7/23: gel

All the temperatures seem to have worked (51 was not loaded due to # lanes on gel). Expected product size ~2.1kb. Ladder is 1KB.

Products from different temperatures combined and gel purified.

P51, 52, 17 MIT

17, 52:
Rx mix (split into 4 samples): 180μL Platinum PCR supermix, 4μL BBpfx primer (20μM), 4μL BBsfx primer (20μM), 4μL miniprepped DNA, 8μL water
51:
Rx mix (split into 4 samples): 100μL AmpliTaq Gold Master Mix, 4μL BBpfx primer (20μM), 4μL BBsfx primer (20μM), 4μL miniprepped DNA, 88μL water

Rx: 5min @ 94°C → 35x[45s @ 94°C → 45s @ {52.7, 53.6, 54.6, 55.5}°C → 1m25s @72°C] → 5min @ 72°C → ∞ @ 4°C

Results

	1.2% agarose E-gel run for 30 min and visualized using EtBr/UV
	Lane	Contents
	1-4	P17 (902) (annealing temp increase LTR)
	5-8	P51 (1370) (annealing temp increase LTR)
	9-11	P53 (987) (annealing temp increase LTR)
	12	1KB plus ladder

P1, P3 backbones; HO-pcyA; P51 MIT

Conditions optimization

Rx: 5min @ 94°C → 35x[45s @ 94°C → 45s @ {middle 8 of 41-55 gradient: 43.3, 44.9, 47.0, 49.3, 51.3, 52.8, 53.9, 54.7}°C → 3m30s @72°C] → 5min @ 72°C → ∞ @ 4°C

P1, P3

PCR product is the backbone of P1 and P3, including the RBS (B0032), weak and strong promoter respectively, and terminator. The ends have unique ApaLI and KpnI cut sites.

Rx mix (split into 8 samples): 180μL Platinum PCR supermix, 4μL P3minusGFP-F primer (20μM), 4μL P3minusGFP-R primer (20μM), 4μL miniprepped DNA (P1/P3), 8μL water

HO-pcyA

Ends have unique ApaLI and KpnI cut sites.

Rx mix (split into 8 samples): 180μL Platinum PCR supermix, 4μL HO-pcyA-F primer (20μM), 4μL HO-pcyA-R primer (20μM), 4μL miniprepped P86, 8μL water

P51 MIT

Rx mix (split into 4 samples): 90μL Platinum PCR supermix, 2μL BBsfx primer (20μM), 2μL BBpfx primer (20μM), 2μL miniprepped P51, 4μL water

Used highest 4 temps of gradient.

Gels

Annealing temp increases LTR.

	1.2% agarose E-gel run for 30 min and visualized using EtBr/UV
	Lane	Contents
	1-8	P1 backbone (~3kb)
	9	1 KB ladder
	10-12	HO-pcyA (~1.4 kb)

	1.2% agarose E-gel run for 30 min and visualized using EtBr/UV
	Lane	Contents
	1-5	HO-pcyA (~1.4 kb)
	6	1 KB ladder
	7-12	P3 backbone (~3 kb)

	1.2% agarose E-gel run for 30 min and visualized using EtBr/UV
	Lane	Contents
	1-2	P3 backbone (~3kb)
	3	1 KB ladder
	4-7	P51 MIT (~1.4 kb)

Full Rx

400 μL (8 reactions) each of P1 and P3 were set up using a doubling of above reaction mix. The reaction conditions were the same except that annealing temperature was 45°C, and cycles occur 40 times.

100 μL (2 reactions) each of HO-pcyA and P51 MIT were set up using above reaction ratios. 40 cycles were performed with 55°C annealing temp and 1:35 extension time.

Products will be gel purified along with products from optimization PCRs.

RE digests 07/22

Gel 1

	1 agarose gel visualized using EtBr/UV
	Lane	Contents
	1	1 kb plus ladder
	2	CDF PCR cut XP (~900)
	3	CDF PCR uncut (~900)
	4	P1A cut XP (2750)
	5	P1A uncut (3669)
	6	P17 cut EX (5327)
	7	P17 uncut (5327)
	8	P48 cut XP (769)
	9	P48 uncut (3477)

Gel 2

	1 agarose gel visualized using EtBr/UV
	Lane	Contents
	1	1 kb plus ladder
	2	P49B cut XP (943)
	3	P49B uncut (3651)
	4	P51 cut EX (5795)
	5	P51 uncut (5795)
	6	P52 cut EX (5412)
	7	P52 uncut (5412)
	8	P63 cut EX (3284)
	9	P63 uncut (3284)

Gel 3

	1 agarose gel visualized using EtBr/UV
	Lane	Contents
	1	1 kb plus ladder
	2	P97A cut EX (2091)
	3	P97A uncut (2091)
	4	P97B cut EX (2091)
	5	P97B uncut (2091)

Cool ligations 07/22

• We ligated P1A (vector) to CDF. We used three different ratios of vector to insert for the ligation: 2/6, 1/5, 1/7.
• Attempted to ligate p40 cut with SP (w/ RBS) to mtrB cut with XP. Thus far, the ligation has not worked.

Recombination Update 07/22

• Thus far, none of the attempts to extract flanking regions from the genomic DNA have worked. We are troubleshooting this now and will run positive controls with known DNA samples to check the efficiency of our Phusion Polimerase.

07/23 Ligations/Transformations

• Ligated p40 cut SP with mtrB cut XP at 2:3, 1:2, 1:4, 1:5, 1:6, positive control is uncut p40, negative control (to test Amp plates) is p29 (Kan)

RE digests 07/23

Gel 1: 1% agarose gel visualized using EtBr/UV	Lane	Contents
	1	1 kb plus ladder
	2	P97A cut SP (2091)
	3	P97A uncut
	4	P97B cut SP (2091)
	5	P97B uncut
	6	P51 cut EX (5795)
	7	P51 uncut
	8	P52 cut EX (5412)
	9	P52 uncut
	10	P90ζ cut SP (~3600)
	11	P90ζ uncut
	12	P90ε cut SP (~3600)
	13	P90ε uncut
	14	mtrB (not BioBrick) uncut PCR product (~2.1kb)

Gel 2: 1% agarose gel visualized using EtBr/UV	Lane	Contents
	1	1 kb plus ladder
	2	P17 cut EX (5327)
	3	P17 uncut
	4	S1P3A B cut XP (2750)
	5	S1P3A B uncut
	6	S1P3A C cut XP (2750)
	7	S1P3A C uncut
	8	P3A cut XP (2750)
	9	P3A uncut
	10	P3B cut XP (2750)
	11	P3B uncut
	12	mtrB BB cut XP (2100)
	13	mtrB BB uncut

Ligations 07/23: mtrB+RBS, CDF into pSB3K3

We ligated

• P97 and mtrB BB
• P3 and CDF

We used three different ratios of insert to vector for the ligation: 6/2, 5/1, 7/1.

We used 5 μL of the ligation to transform TOP10 cells and 5 μL to transform the new DH5α cells. We also used 1 μL and 3 μL to transform DH5α. We used pUC19 (1 μL) as a positive control to test the efficacy of the new DH5α cells.

We used Jason's protocol to transform the new DH5α cells:

• Thaw cells by resting tubes on ice
• Then add DNA and mix by swirling with the pipette tip
• Incubate the cells with DNA in ice for 10min
• Heat shock at 42C for 2min
• Then incubate in ice for 2-5min
• Add 500-700ml LB (or SOC) and incubate + 250rpm shaking for 1hr at 37C
• Plate

Results

Strain	DNA	Vector:Insert (μL)	Amount transformed (μL)	Plate	# colonies
E1	pUC19	n/a	1	AMP	40
E1	-	n/a	-	CARB	0
E2	P97+ mtrB BioBrick	2:6	5	CARB	136
E2	P97+ mtrB BioBrick	1:5	5	CARB	48
E2	P97+ mtrB BioBrick	1:7	5	CARB	64
E1	P97+ mtrB BioBrick	1:7	1	CARB	0
E1	P97+ mtrB BioBrick	1:7	3	CARB	0
E1	P97+ mtrB BioBrick	1:7	5	CARB	4
E1	P97+ mtrB BioBrick	1:5	1	CARB	0
E1	P97+ mtrB BioBrick	1:5	1	CARB	0
E1	P97+ mtrB BioBrick	1:5	1	CARB	0
E1	P97+ mtrB BioBrick	2:6	1	CARB	1
E1	P97+ mtrB BioBrick	2:6	1	CARB	7
E1	P97+ mtrB BioBrick	2:6	1	CARB	9
E2	P3+CDF	2:6	5	KAN	7
E2	P3+CDF	1:5	5	KAN	56
E2	P3+CDF	1:7	5	KAN	5
E1	P3+CDF	1:7	1	KAN	0
E1	P3+CDF	1:7	3	KAN	2
E1	P3+CDF	1:7	5	KAN	0
E1	P3+CDF	1:5	1	KAN	0
E1	P3+CDF	1:5	3	KAN	0
E1	P3+CDF	1:5	5	KAN	0
E1	P3+CDF	2:6	1	KAN	0
E1	P3+CDF	2:6	3	KAN	1
E1	P3+CDF	2:6	5	KAN	0

• Try 45s heat shock and SOC for new cells
• Try 3 or 5 μL transformations
• New Carb plates seem fine

Ligations 07/24

We ligated p75a w/ p63 w/ a ratio of 4ul p63:1ul p75a

Transformed into new dh5α competent cells w/ volumes of 1, 3, and 5uL, using Jason's new protocol. As a control transformed 1uL of pUC19.

RE digests 07/24

	1% agarose gel visualized using EtBr/UV
	Lane	Contents
	1	1 kb ladder
	2	P1A uncut (~3600)
	3	P1A cut EP (~3600)
	4	P3A uncut (~3600)
	5	P3A cut EP (~3600)
	6	P17 PCR cut XP (902)
	7	P52 PCR cut XP (987)
	8	P90.4 uncut (~3600)
	9	P90.1 cut SP (~3600)
	10	P90.2 cut SP (~3600)
	11	P90.3 cut SP (~3600)
	12	P90.4 cut SP (~3600)

RE digests 07/25

0000

DNA	Strain	Plate	# Colonies
P1+P17	E2	KAN	184
P1+P17	E1	KAN	9
P1+P17	E1	KAN	9
P1+P52	E2	KAN	40
P1+P52	E1	KAN	0
P1+P52	E1	KAN	0
P3+P17	E2	KAN	10
P3+P17	E1	KAN	0
P3+P17	E1	KAN	0
P3+P52	E2	KAN	48
P3+P52	E1	KAN	1
P3+P52	E1	KAN	1
P38+P17	E2	KAN	1
P38+P17	E1	KAN	0
P38+P17	E1	KAN	0
P38+P51	E2	KAN	32
P38+P51	E1	KAN	1
P38+P51	E1	KAN	0
P38+P52	E2	KAN	1
P38+P52	E1	KAN	0
P38+P63	E1	KAN	0
P39+P17	E1	KAN	0
P39+P17	E1	KAN	0
P39+P17	E2	KAN	0
P39+P51	E2	KAN	5
P39+P51	E1	KAN	2
P39+P51	E1	KAN	2
P39+P52	E2	KAN	6
P39+P52	E1	KAN	1
P39+P52	E1	KAN	1
P90+P48	E2	CM	16
P90+P48	E1	CM	5
P90+P48	E1	CM	1
P90+P49	E2	AMP	TMTC
P90+P49	E1	AMP	19
P90+P49	E1	AMP	4
pUC19	E1	AMP	192