IGEM:Harvard/2009/Notebook/Harvard iGEM 2010/2010/07/07: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
Line 30: Line 30:
===Primers for Wintergreen pathway parts===
===Primers for Wintergreen pathway parts===


''J45004''
'''J45004'''
</br>
Left Primer: 5'cctttctagaatggaagttgttgaagttcttca 3'
Left Primer: 5'cctttctagaatggaagttgttgaagttcttca 3'
Right Primer: 5'aaggctgcagcggccgctactagtttaatttattttggtcaagga 3'  (last 5 bp omitted to meet 45 bp maximum)
Right Primer: 5'aaggctgcagcggccgctactagtttaatttattttggtcaagga 3'  (last 5 bp omitted to meet 45 bp maximum)


''J45017''
'''J45017'''
Left Primer:  5'cctttctagaatgaaaactcccgaagactgc 3'
Left Primer:  5'cctttctagaatgaaaactcccgaagactgc 3'
Right Primer:  5'aaggctgcagcggccgctactagtttattaggcgacgccgc 3'
Right Primer:  5'aaggctgcagcggccgctactagtttattaggcgacgccgc 3'





Revision as of 11:05, 7 July 2010

iGEM iGarden <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Team Flavor

  • Can he handle the flavor? Chew on that question.

Sequencing

V0120 Plasmids containing the pENTCUP2 plant promoter, NOS terminator and NOS terminator + STOP were sent to GENEWIZ for sequencing. Sequencing results are expected tomorrow.

Sequencing Order


Cultures

5 mL cultures were started from the YFP-2x construct from yesterday, as well as the B15 (StrepII) tag.

  • 2 x B21 E/X + Brazz E/S - C-Terminus
  • 2 x B21 S/P + Brazz X/P - N-Terminus
  • 2 x B21 E/X + Mira E/S - C-Terminus
  • 2 x B21 S/P + Mira X/P - N-Terminus
  • 2 x B15 Plate #1
  • 2 x B15 Plate #2

Cultures were placed in a 37°C incubator and left to shake overnight.


Primers for Wintergreen pathway parts

J45004

  • Left Primer: 5'cctttctagaatggaagttgttgaagttcttca 3'
  • Right Primer: 5'aaggctgcagcggccgctactagtttaatttattttggtcaagga 3' (last 5 bp omitted to meet 45 bp maximum)

J45017

  • Left Primer: 5'cctttctagaatgaaaactcccgaagactgc 3'
  • Right Primer: 5'aaggctgcagcggccgctactagtttattaggcgacgccgc 3'