IGEM:Harvard/2009/Notebook/Harvard iGEM 2010/2010/07/07: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 42: Line 42:


===Results===
===Results===
====Transformation of pHannibal pKannibal====
'''Transformation of pHannibal pKannibal'''
The transformation we started yesterday of pH and pK didn't work (no growth on either plate).


This transformation we performed slightly differently from the one yesterday. This protocol is nicknamed the "quick and dirty transform." The transformation we started yesterday of pH and pK didn't work (no growth on either plate).


====Gel of PCR of PDK intron====
Quick and Dirty Transform:
#Mix
##2ul 10x {pHannibal, pKannibal}
##20ul Turbo E. Coli
##220ul SOC Broth
#Plate on {LB+(pHannibal->LB+Amp, pKannibal->LB+Kan), LB} Agar, grow
 
'''Gel of PCR of PDK intron'''
Didn't work. Our theory is that the Tm we used (the one IDT sent us) was too high. IDT assumes that the entire primer is going to anneal to a strand of DNA when they calculate their Tm, but since half of our primer won't anneal (the half that doesn't anneal was used to prepend/postpend the biobrick sequences) the Tm IDT calculates will be too high. Here are more correct calculations from Primer3:
Didn't work. Our theory is that the Tm we used (the one IDT sent us) was too high. IDT assumes that the entire primer is going to anneal to a strand of DNA when they calculate their Tm, but since half of our primer won't anneal (the half that doesn't anneal was used to prepend/postpend the biobrick sequences) the Tm IDT calculates will be too high. Here are more correct calculations from Primer3:
<pre>
<pre>

Revision as of 13:20, 7 July 2010

iGEM iGarden <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Team Allergy

Yesterday, we ended by transforming pKannabil and pHannibal into E. coli and running a diagnostic digest of digested allergen panel. Yesterday's plates did not grow, and the diagnostic digest did not have good results.

Today, we will be re-digesting the allergen panel plasmids to see if we can get a good result and re-growing pKannabil and pHannibal (vectors from the first extraction from yesterday). If the digested allergen panel runs correctly on a gel, then we will send the plasmids off for sequencing. If nothing gel does not run correctly, then we will go back to re-digest V0120 with a death gene insert instead of YFP and ligate allergen inserts, transform, miniprep, and see if we get the correct insert. If some run correctly and some did not, we will collect more samples from our culture plates for the allergens that did not work and redo the digests until we find a sample with the correct plasmid. If the pKannabil and pHannibal plates grow, then we will miniprep to purify the plasmids containing the PDK intron, PCR the intron, and purify the intron.

Today, we are also running the PDK intron obtained yesterday to see if it is the correct length.

First thing tomorrow, we will culture E. coli containing plasmids for our allergen panel to obtain more plasmids.

Procedures

For pKannabil and pHannibal:

  1. Electronic Gel Electrophoresis of PDK introns (from PCR reaction yesterday, PCR off DNA from the eluted vectors)
  2. Re-grow E. coli containing pKannabil and pHannibal plasmids
  3. Culture colonies
  4. Miniprep colonies
  5. PCR for PDK intron
  6. Diagnostic Gel to check for correct length
  7. Repeat PCR of PDK intron using different Tm.

For Allergen panel

  1. Digest of Plasmids containing allergen inserts
  2. Diagnostic Gel
  3. Collect additional samples for allergens that did not work

Xfrm of pHannibal, pKannibal Mk. II

This transformation we performed slightly differently. This protocol is nicknamed the "quick and dirty transform." Quick and Dirty Transform:

  1. Mix
    1. 2ul 10x {pHannibal, pKannibal}
    2. 20ul Turbo E. Coli
    3. 220ul SOC Broth
  2. Plate on {LB+(pHannibal->LB+Amp, pKannibal->LB+Kan), LB} Agar, grow


Results

Transformation of pHannibal pKannibal

This transformation we performed slightly differently from the one yesterday. This protocol is nicknamed the "quick and dirty transform." The transformation we started yesterday of pH and pK didn't work (no growth on either plate).

Quick and Dirty Transform:

  1. Mix
    1. 2ul 10x {pHannibal, pKannibal}
    2. 20ul Turbo E. Coli
    3. 220ul SOC Broth
  2. Plate on {LB+(pHannibal->LB+Amp, pKannibal->LB+Kan), LB} Agar, grow

Gel of PCR of PDK intron Didn't work. Our theory is that the Tm we used (the one IDT sent us) was too high. IDT assumes that the entire primer is going to anneal to a strand of DNA when they calculate their Tm, but since half of our primer won't anneal (the half that doesn't anneal was used to prepend/postpend the biobrick sequences) the Tm IDT calculates will be too high. Here are more correct calculations from Primer3: 

OLIGO            start  len      tm     gc%   any    3' seq 

LEFT PRIMER       4229   20   51.11   30.00  8.00  3.00 CCAATTGGTAAGGAAATAAT
RIGHT PRIMER      5021   20   61.95   45.00  6.00  0.00 TTCGAACCCAATTTCCCAAC

Team Fence

Team Flavor

  • Can he handle the flavor? Chew on that question.

Sequencing

V0120 Plasmids containing the pENTCUP2 plant promoter, NOS terminator and NOS terminator + STOP were sent to GENEWIZ for sequencing. Sequencing results are expected tomorrow.

Sequencing Order


Cultures

5 mL cultures were started from the YFP-2x construct from yesterday, as well as the B15 (StrepII) tag.

  • 2 x B21 E/X + Brazz E/S - C-Terminus
  • 2 x B21 S/P + Brazz X/P - N-Terminus
  • 2 x B21 E/X + Mira E/S - C-Terminus
  • 2 x B21 S/P + Mira X/P - N-Terminus
  • 2 x B15 Plate #1
  • 2 x B15 Plate #2

Cultures were placed in a 37°C incubator and left to shake overnight.


Primers for Wintergreen pathway parts

J45004

  • Left Primer: 5' cctttctagaatggaagttgttgaagttcttca 3'
  • Right Primer: 5' aaggctgcagcggccgctactagtttaatttattttggtcaagga 3' (last 5 bp omitted to meet 45 bp maximum)

J45017

  • Left Primer: 5' cctttctagaatgaaaactcccgaagactgc 3'
  • Right Primer: 5' aaggctgcagcggccgctactagtttattaggcgacgccgc 3'



Retrieved from "https://openwetware.org/mediawiki/index.php?title=IGEM:Harvard/2009/Notebook/Harvard_iGEM_2010/2010/07/07&oldid=430552"