IGEM:Harvard/2009/Notebook/Harvard iGEM 2010/2010/07/20: Difference between revisions
(2 intermediate revisions by one other user not shown) | |||
Line 11: | Line 11: | ||
==Team Allergy== | ==Team Allergy== | ||
Today, we plated the transformations that we did yesterday. We are also expecting sequences for amiRNA that we ordered yesterday. | |||
===Procedures=== | |||
#Plating transformants | |||
#Check sequences | |||
===Results=== | |||
'''Plating Transformations''' | |||
One plate of each allergen S and A and the introns PAL and PME. All but BetS and PME had colonies | |||
'''Sequencing Results for amiRNA''' | |||
Not one matched the sequences that we wanted. The customization sequences that we wanted (our miRNA sequence+ a little bit of RS300) were not present in all of the LTP and Bet sequences sent in. Even the Biobrick ends were not present in the sequences except for GFP, from our earlier sequencing order. | |||
What could have gone wrong? We suspect that the RS300 vector that was given to use already contains an interference sequence. The sequence that we used to design our primers are based on an RS300 vector without any inserted interference sequence. Christina has already sent an email to the lab that gave us the RS300 asking if the RS300 contains any interference, possibly GFP. That would explain our results. | |||
It is possible that we will have to go back and redo PCR ~ transformation. These results are all still from the first time that we tried making amiRNA parts, just different colonies. | |||
<html><pre> | <html><pre> | ||
"c1" and "c2" are the customization (mutagenesis) sites corresponding to the capitalized portions of the primers suggested by the WMD3 tool. | "c1" and "c2" are the customization (mutagenesis) sites corresponding to the capitalized portions of the primers suggested by the WMD3 tool. | ||
Line 61: | Line 73: | ||
RS300 Backbone TATGGACTGAAGGGGACCCGT ACAGGTCCCCTTCTGTCCATT | RS300 Backbone TATGGACTGAAGGGGACCCGT ACAGGTCCCCTTCTGTCCATT | ||
</pre></html> | </pre></html> | ||
==Team Fence== | |||
No colonies from last night's ligation. | |||
[[Image:5xGalpt_Lig_7-19.jpg|350px]] | |||
[[Image:B21_lig_7-19.jpg|350px]] | |||
[[Image:NLS.Serine_Lig_7-19.jpg|350px]] | |||
===Re-doing 5xGalpt and NLS.Serine Annealing Reactions=== | |||
Set ~400ml of water to boil in a beaker on a heat block. | |||
Phosphorylating 5xGalpt | |||
*3μL 100μM oligo1.5xgal4 | |||
*3μL 100μM oligo2.5xgal4 | |||
*3μL 100μM oligo3.5xgal4 | |||
*3μL 100μM oligo4.5xgal4 | |||
*3μL 10x PNK buffer | |||
*2μL nM ATP | |||
*2μL t4 PNK | |||
*11μL DH<sub>2</sub>O | |||
put in 37°C waterbath for 90 mins | |||
Then added 4μL 5M NaCl to halt the reaction | |||
To get rid of the NaCL so that I can ligate the overlapping oligos: | |||
*added 3 volues of 100% ethanol (90μL), spun at top speed for 20 mins | |||
*pippetted off and discarded the supernatant, added 100μL of 70% ethanol, broke up the pellet, and spun for 5 mins | |||
*pippeted off supernatant, allowed to air dry. | |||
*added 2μL T4 ligase buffer, 1μL T4 ligase, and 17μL DH<sub>2</sub>O, using this mix to resuspend the pellet | |||
*set in PCR machine at 16°C for 12 hours, then 4°C until stopped. | |||
===Annealing NLS.Serine (again)=== | |||
*3μL NLS.Serine.Fwd | |||
*3μL NLS.Serine.Rev | |||
*2μL 10x annealing buffer | |||
*12μL DH<sub>2</sub>O | |||
Put in boiling water in beaker (see above), allowed to boil for 2 mins, then removed beaker from heat block, allowing the water to slowly cool with the annealing reaction tube still in it. | |||
<!-- ## Do not edit below this line unless you know what you are doing. ## --> | <!-- ## Do not edit below this line unless you know what you are doing. ## --> | ||
|} | |} |
Revision as of 15:44, 26 July 2010
iGEM iGarden | <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page <html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html> </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html> |
Team Flavor
Team AllergyToday, we plated the transformations that we did yesterday. We are also expecting sequences for amiRNA that we ordered yesterday. Procedures
ResultsPlating Transformations One plate of each allergen S and A and the introns PAL and PME. All but BetS and PME had colonies Sequencing Results for amiRNA Not one matched the sequences that we wanted. The customization sequences that we wanted (our miRNA sequence+ a little bit of RS300) were not present in all of the LTP and Bet sequences sent in. Even the Biobrick ends were not present in the sequences except for GFP, from our earlier sequencing order. What could have gone wrong? We suspect that the RS300 vector that was given to use already contains an interference sequence. The sequence that we used to design our primers are based on an RS300 vector without any inserted interference sequence. Christina has already sent an email to the lab that gave us the RS300 asking if the RS300 contains any interference, possibly GFP. That would explain our results. It is possible that we will have to go back and redo PCR ~ transformation. These results are all still from the first time that we tried making amiRNA parts, just different colonies. <html><pre> "c1" and "c2" are the customization (mutagenesis) sites corresponding to the capitalized portions of the primers suggested by the WMD3 tool. "c1" corresponds to the capitalized region of what WMD3 calls primer3 and to the reverse compliment of the capitalized region of primer4. Similarly, "c2" corresponds to the capitalized region of primer1 and the reverse complement of the capitalized region of primer2. For instance, WMD3 gives us the following when asked to design primers for the BET sequence: primer1: gaTTGGTTATATATATCGCACCTtctctcttttgtattcc primer2: gaAGGTGCGATATATATAACCAAtcaaagagaatcaatga primer3: gaAGATGCGATATATTTAACCATtcacaggtcgtgatatg primer4: gaATGGTTAAATATATCGCATCTtctacatatatattcct In the sequence itself, the File c1 Seen c2 Seen ----- First Sequencing Batch ------------ BETF-Fwd.seq TTGGACTGAAGGGAGCTCCC GAGAGCTTCCTTGAGTCCAT BETR-Rev.seq TTGGACTGAAGGGAGCTCCC GAGAGCTTCCTTGAGTCCAT ----- Second Sequencing Batch ----------- bet_2_f-forw TTGGACTGAAGGGAGCTCCC GAGAGCTTCCTTGAGTCCAT bet_3_f-forw TTGGACTGAAGGGAGCTCCC GAGAGCTTCCTTGAGTCCAT ----- Third Sequencing Batch ------------ BET1F-f.seq TTGGACTGAAGGGAGCTCCC GAGAGCTTCCTTGAGTCCAT BET1R-rev.seq TTGGACTGAAGGGAGCTCCC GAGAGCTTCCTTGAGTCCAT BET2F-f.seq TTGGACTGAAGGGAGCTCCC GAGAGCTTCCTTGAGTCCAT BET2R-rev.seq TTGGACTGAAGGGAGCTCCC GAGAGCTTCCTTGAGTCCAT BET3F-f.seq TTGGACTGAAGGGAGCTCCC GAGAGCTTCCTTGAGTCCAT BET3R-rev.seq TTGGACTGAAGGGAGCTCCC GAGAGCTTCCTTGAGTCCAT BET4F-f.seq TTGGACTGAAGGGAGCTCCC GAGAGCTTCCTTGAGTCCAT BET4R-rev.seq TTGGACTGAAGGGAGCTCCC GAGAGCTTCCTTGAGTCCAT BET5F-f.seq TTGGACTGAAGGGAGCTCCC GAGAGCTTCCTTGAGTCCAT BET5R-rev.seq TTGGACTGAAGGGAGCTCCC GAGAGCTTCCTTGAGTCCAT BET6F-f.seq TTGGACTGAAGGGAGCTCCC GAGAGCTTCCTTGAGTCCAT BET6R-rev.seq TTGGACTGAAGGGAGCTCCC GAGAGCTTCCTTGAGTCCAT LTP1F-fwd.seq TTGGACTGAAGGGAGCTCCC GAGAGCTTCCTTGAGTCCAT ... ----- Theoretical Expectations ---------- RS300 Plasmid TTGGACTGAAGGGAGCTCCC GAGAGCTTCCTTGAGTCCAT Bet.ape AGATGCGATATATTTAACCAT TTGGTTATATATATCGCACCT GFP.ape GTACAGCTCGCCGTCCACTAT TTAGTGGTCGGCGAGCTGCAC LTP.ape GTAGTCCTATACAAAGTTAGT TCTAACTATGTATAGGACCAC RS300.ape TATGGACTGAAGGGGACCCGT ACAGGTCCCCTTCTGTCCATT RS300 Backbone TATGGACTGAAGGGGACCCGT ACAGGTCCCCTTCTGTCCATT </pre></html>
Team FenceNo colonies from last night's ligation.
Re-doing 5xGalpt and NLS.Serine Annealing ReactionsSet ~400ml of water to boil in a beaker on a heat block. Phosphorylating 5xGalpt
put in 37°C waterbath for 90 mins Then added 4μL 5M NaCl to halt the reaction To get rid of the NaCL so that I can ligate the overlapping oligos:
Annealing NLS.Serine (again)
Put in boiling water in beaker (see above), allowed to boil for 2 mins, then removed beaker from heat block, allowing the water to slowly cool with the annealing reaction tube still in it.
|