IGEM:Harvard/2009/Notebook/Harvard iGEM 2010/2010/07/20

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Team Allergy)
Line 73: Line 73:
RS300 Backbone TATGGACTGAAGGGGACCCGT ACAGGTCCCCTTCTGTCCATT
RS300 Backbone TATGGACTGAAGGGGACCCGT ACAGGTCCCCTTCTGTCCATT
</pre></html>
</pre></html>
 +
 +
 +
==Team Fence==
 +
 +
No colonies from last night's ligation.
 +
 +
[[Image:5xGalpt_Lig_7-19.jpg|350px]]
 +
[[Image:B21_lig_7-19.jpg|350px]]
 +
[[Image:NLS.Serine_Lig_7-19.jpg|350px]]
<!-- ## Do not edit below this line unless you know what you are doing. ## -->
<!-- ## Do not edit below this line unless you know what you are doing. ## -->
|}
|}

Revision as of 13:09, 23 July 2010

iGEM iGarden Main project page
Previous entry      Next entry

Team Flavor

  • Picked colonies from Mira/Brazz StrepII STOP constructs
    • Only Mira N and Brazz C had colonies, 2 mL cultures were started and will be miniprepped to confirm ligation at the end of today.
  • Diluted Mira/Brazz YFP expression colonies 25:1 in LB+AMP for eventual IPTG induction. Will culture @ 37°C for 1 hour then take O/D's.

Team Allergy

Today, we plated the transformations that we did yesterday. We are also expecting sequences for amiRNA that we ordered yesterday.

Procedures

  1. Plating transformants
  2. Check sequences

Results

Plating Transformations One plate of each allergen S and A and the introns PAL and PME. All but BetS and PME had colonies

Sequencing Results for amiRNA

Not one matched the sequences that we wanted. The customization sequences that we wanted (our miRNA sequence+ a little bit of RS300) were not present in all of the LTP and Bet sequences sent in. Even the Biobrick ends were not present in the sequences except for GFP, from our earlier sequencing order.

What could have gone wrong? We suspect that the RS300 vector that was given to use already contains an interference sequence. The sequence that we used to design our primers are based on an RS300 vector without any inserted interference sequence. Christina has already sent an email to the lab that gave us the RS300 asking if the RS300 contains any interference, possibly GFP. That would explain our results.

It is possible that we will have to go back and redo PCR ~ transformation. These results are all still from the first time that we tried making amiRNA parts, just different colonies.

"c1" and "c2" are the customization (mutagenesis) sites corresponding to the capitalized portions of the primers suggested by the WMD3 tool. 
"c1" corresponds to the capitalized region of what WMD3 calls primer3 and to the reverse compliment of the capitalized region of primer4. 
Similarly, "c2" corresponds to the capitalized region of primer1 and the reverse complement of the capitalized region of primer2. 
For instance, WMD3 gives us the following when asked to design primers for the BET sequence:
primer1:	gaTTGGTTATATATATCGCACCTtctctcttttgtattcc
primer2:	gaAGGTGCGATATATATAACCAAtcaaagagaatcaatga
primer3:	gaAGATGCGATATATTTAACCATtcacaggtcgtgatatg
primer4:	gaATGGTTAAATATATCGCATCTtctacatatatattcct

In the sequence itself, the 

File		c1 Seen			c2 Seen
----- First Sequencing Batch ------------
BETF-Fwd.seq	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT
BETR-Rev.seq	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT
----- Second Sequencing Batch -----------
bet_2_f-forw	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT
bet_3_f-forw	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT	
----- Third Sequencing Batch ------------
BET1F-f.seq	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT
BET1R-rev.seq	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT
BET2F-f.seq	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT
BET2R-rev.seq	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT
BET3F-f.seq	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT
BET3R-rev.seq	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT
BET4F-f.seq	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT
BET4R-rev.seq	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT
BET5F-f.seq	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT
BET5R-rev.seq	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT
BET6F-f.seq	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT
BET6R-rev.seq	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT
LTP1F-fwd.seq	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT
...
----- Theoretical Expectations ----------
RS300 Plasmid	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT
Bet.ape		AGATGCGATATATTTAACCAT	TTGGTTATATATATCGCACCT
GFP.ape		GTACAGCTCGCCGTCCACTAT	TTAGTGGTCGGCGAGCTGCAC
LTP.ape		GTAGTCCTATACAAAGTTAGT	TCTAACTATGTATAGGACCAC
RS300.ape	TATGGACTGAAGGGGACCCGT	ACAGGTCCCCTTCTGTCCATT
RS300 Backbone	TATGGACTGAAGGGGACCCGT	ACAGGTCCCCTTCTGTCCATT


Team Fence

No colonies from last night's ligation.


Personal tools