IGEM:Harvard/2009/Notebook/Harvard iGEM 2010/2010/07/28: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
| Line 6: | Line 6: | ||
| colspan="2"| | | colspan="2"| | ||
==Team Flavor== | ==Team Flavor== | ||
===PCR Confirmation=== | |||
* Ran gel to confirm Valencene PCR: <font color="red">failed</font> | * Ran gel to confirm Valencene PCR: <font color="red">failed</font> | ||
[[Image:ValPfxConfirm.jpg|240px]] | [[Image:ValPfxConfirm.jpg|240px]] | ||
| Line 16: | Line 17: | ||
''The numerical differentiation refers to the specific genomic DNA sample'' | ''The numerical differentiation refers to the specific genomic DNA sample'' | ||
===PCR of Wintergreen parts=== | |||
* Ran PCR to extract J45004 and J45017 parts from the Wintergreen Pathway | * Ran PCR to extract J45004 and J45017 parts from the Wintergreen Pathway | ||
| Line 29: | Line 31: | ||
The PCR reaction was set-up as per the specifications from the Phusion Polymerase manual (http://www.neb.com/nebecomm/ManualFiles/manualF-530.pdf). For template DNA, '''3.5 ng''' of the '''J45700''' BioBrick part (the entire wintergreen pathway) was used. <br/> | The PCR reaction was set-up as per the specifications from the Phusion Polymerase manual (http://www.neb.com/nebecomm/ManualFiles/manualF-530.pdf). For template DNA, '''3.5 ng''' of the '''J45700''' BioBrick part (the entire wintergreen pathway) was used. <br/> | ||
[[Image:PhusionDetails.png|240px]] | [[Image:PhusionDetails.png|240px]] [[Image:PhusionCycle.png|240px]] | ||
Revision as of 12:02, 28 July 2010
 iGEM iGarden
|
<html><img src="/images/9/94/Report.png" border="0" /></html> Main project page <html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html> </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html> |
Team FlavorPCR Confirmation
The numerical differentiation refers to the specific genomic DNA sample PCR of Wintergreen parts
Primers:
J45004_F
Left Primer: 5' cctttctagaatggaagttgttgaagttcttca 3'
J45004_R
Right Primer: 5' aaggctgcagcggccgctactagtttaatttattttggtcaagga 3' (last 5 bp omitted to meet 45 bp maximum)
J45017_F
Left Primer: 5' cctttctagaatgaaaactcccgaagactgc 3'
J45017_R
Right Primer: 5' aaggctgcagcggccgctactagtttattaggcgacgccgc 3'
The PCR reaction was set-up as per the specifications from the Phusion Polymerase manual (http://www.neb.com/nebecomm/ManualFiles/manualF-530.pdf). For template DNA, 3.5 ng of the J45700 BioBrick part (the entire wintergreen pathway) was used.
| |
