IGEM:Harvard/2009/Notebook/Harvard iGEM 2010/2010/07/28: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 112: Line 112:
| 58.5 || 2.03
| 58.5 || 2.03
|-
|-
! +++++++++++
! RXRLc 5
| 339.4 || 1.92
| 45.1 || 2.06
|-
! ACC 3
| 91.5 || 2.01
|-
! Barn 2 Strep 3
| 41.0 || 2.12
|-
! Barn 2 Strep 2
| 90.3 || 1.95
|-
! Barn 1 Strep 2
| 67.1 || 1.99
|-
! Barn 1 Strep 3
| 92.9 || 1.99
|-
! EcR 5
| 115.3 || 1.95
|-
! EcR 2
| 108.0 || 1.97
|-
! EcR 4
| 79.4|| 1.97
|-
! EcR 3
| 111.6 || 1.96
|-
! EcR 6
| 95.8 || 1.96
|-
|-
! LacIN 4
| 368.9 || 1.92
|}
|}


===Barnase Digest Gel Extraction===
===Barnase Digest Gel Extraction===

Revision as of 11:27, 12 August 2010

iGEM iGarden <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Team Allergy

Protocol

Yesterday, we plated E. coli containing complete hpRNA for Ger, Bet v2, and LTP. Bet v1 did not ligate properly in the earlier Sense+Intron ligation.

Today, we will extract the plasmids from the E. coli and prepare them for sequencing tomorrow. We will also do ligations with the false negatives (Sense + PDK ligate with Antisense).

  1. Culture colonies
  2. Miniprep
  3. Nanodrop

For our false negatives

  1. Ligate
  2. Transform

Results

Nanodrop

The format is: Miniprep # , Name of Allergen, concentration in ng/μL of colony 1, concentration in ng/μL of colony 2. All these working ligations are with the PAL intron

  1. 9, LTP, 97.9, 94.1
  2. 11, LTP, 77.9, 94.8
  3. 25, Bet v2, 67.8, 97.8 (there was a mixup with colony 1 and LTP+PDK, but it is now fixed in our electronic notebooks)
  4. 28, Bet v2, 73.2, 83.6
  5. 36, Ger3, 76.1, 83.4
  6. 37, Ger3, 70.0, 75.3
  7. 38, Ger3, 90.4, 108.3

Transformed more sense+pdk parts for our false negatives (16,30,31)

The parts already have been digested and purified, so today, all we had to do was ligate and transform.

Team Flavor

PCR Confirmation

  • Ran gel to confirm Valencene PCR: failed

  1. Ladder
  2. DNA 1-1
  3. DNA 1-2
  4. DNA 2-1
  5. DNA 2-2
  6. Ladder

The numerical differentiation refers to the specific genomic DNA sample

PCR of Wintergreen parts

  • Ran PCR to extract J45004 and J45017 parts from the Wintergreen Pathway
   Primers: 
    J45004_F
    Left Primer: 5' cctttctagaatggaagttgttgaagttcttca 3'
    J45004_R
    Right Primer: 5' aaggctgcagcggccgctactagtttaatttattttggtcaagga 3' (last 5 bp omitted to meet 45 bp maximum)
    J45017_F
    Left Primer: 5' cctttctagaatgaaaactcccgaagactgc 3'
    J45017_R
    Right Primer: 5' aaggctgcagcggccgctactagtttattaggcgacgccgc 3'

The PCR reaction was set-up as per the specifications from the Phusion Polymerase manual (http://www.neb.com/nebecomm/ManualFiles/manualF-530.pdf). For template DNA, 3.5 ng of the J45700 BioBrick part (the entire wintergreen pathway) was used.

An annealing temperature of 62°C for 15s was used. Polymerase was allowed to extend for 60s; Phusion Polymerase extends at 1kb/15s, our longest construct is 1.7 kb

PCR Confirmation

  1. Ladder
  2. J45004 PCR #1
  3. J45004 PCR #2
  4. J45017 PCR #1
  5. J45017 PCR #2
  6. Ladder
  • Both J45004 PCR reactions appear to have worked, with product at the expected size of 1.1 kb.
  • The J45017 PCR reactions appears to have amplified some of the wrong sequence, as suggested by the short DNA fragment. However, the longer ~2 kb fragment in PCR #1 does appear to be around the correct length.

Team Fence

Minipreps

Miniprepped and Nanodroped the following:

Plasmid Quantity (ng/μL) 260/280
Act2LacO 1 46.1 1.92
RXRHm 4 23.8 2.15
RXRHm 2 45.2 1.94
Terminator 6 172.8 1.93
Terminator 3 456.5 1.91
RXRLc 2 42.7 1.76
RXRLc 4 58.5 2.03
RXRLc 5 45.1 2.06
ACC 3 91.5 2.01
Barn 2 Strep 3 41.0 2.12
Barn 2 Strep 2 90.3 1.95
Barn 1 Strep 2 67.1 1.99
Barn 1 Strep 3 92.9 1.99
EcR 5 115.3 1.95
EcR 2 108.0 1.97
EcR 4 79.4 1.97
EcR 3 111.6 1.96
EcR 6 95.8 1.96

Barnase Digest Gel Extraction

Again blank on the first attempt, tried again:

Success!

2 5 8 9 10 18
DNA KB+ ladder 15μL Barnase2 digest 1/5 dilution 7/23 20μL 1/3 dilution Barn2 digest cleanup 7/23 5μL 1/3 dilution Barn2 digest cleanup 7/23 20μL 1/3 dilution Barn2 digest cleanup 7/23 KB+ ladder



Retrieved from "https://openwetware.org/mediawiki/index.php?title=IGEM:Harvard/2009/Notebook/Harvard_iGEM_2010/2010/07/28&oldid=443966"