IGEM:Harvard/2009/Notebook/Harvard iGEM 2010/2010/07/28: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
| Line 34: | Line 34: | ||
''An annealing temperature of 62°C for 15s was used. Polymerase was allowed to extend for 60s; Phusion Polymerase extends at 1kb/15s, our longest construct is 1.7 kb'' | ''An annealing temperature of 62°C for 15s was used. Polymerase was allowed to extend for 60s; Phusion Polymerase extends at 1kb/15s, our longest construct is 1.7 kb'' | ||
''PCR Confirmation'' | ''PCR Confirmation'' <br/> | ||
[[Image:004017PCRconfirm.jpg|240px]] | [[Image:004017PCRconfirm.jpg|240px]] | ||
#Ladder | #Ladder | ||
#J45004 PCR 1 | #J45004 PCR #1 | ||
#J45004 PCR 2 | #J45004 PCR #2 | ||
#J45017 PCR 1 | #J45017 PCR #1 | ||
#J45017 PCR 2 | #J45017 PCR #2 | ||
#Ladder | #Ladder | ||
Revision as of 06:35, 29 July 2010
 iGEM iGarden
|
<html><img src="/images/9/94/Report.png" border="0" /></html> Main project page <html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html> </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html> |
Team FlavorPCR Confirmation
The numerical differentiation refers to the specific genomic DNA sample PCR of Wintergreen parts
Primers:
J45004_F
Left Primer: 5' cctttctagaatggaagttgttgaagttcttca 3'
J45004_R
Right Primer: 5' aaggctgcagcggccgctactagtttaatttattttggtcaagga 3' (last 5 bp omitted to meet 45 bp maximum)
J45017_F
Left Primer: 5' cctttctagaatgaaaactcccgaagactgc 3'
J45017_R
Right Primer: 5' aaggctgcagcggccgctactagtttattaggcgacgccgc 3'
The PCR reaction was set-up as per the specifications from the Phusion Polymerase manual (http://www.neb.com/nebecomm/ManualFiles/manualF-530.pdf). For template DNA, 3.5 ng of the J45700 BioBrick part (the entire wintergreen pathway) was used. PCR Confirmation
Team FenceMiniprepsBarnase Digest Gel ExtractionSuccess!
| |
