IGEM:Harvard/2009/Notebook/Harvard iGEM 2010/2010/07/28

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Team Flavor)
Line 8: Line 8:
* Ran gel to confirm Valencene PCR: <font color="red">failed</font>
* Ran gel to confirm Valencene PCR: <font color="red">failed</font>
[[Image:ValPfxConfirm.jpg|240px]]
[[Image:ValPfxConfirm.jpg|240px]]
 +
# Ladder
 +
# DNA 1-1
 +
# DNA 1-2
 +
# DNA 2-1
 +
# DNA 2-2
 +
''The numerical differentiation refers to the specific genomic DNA sample''
* Ran PCR to extract J45004 and J45017 parts from the Wintergreen Pathway
* Ran PCR to extract J45004 and J45017 parts from the Wintergreen Pathway

Revision as of 14:36, 28 July 2010

iGEM iGarden Main project page
Previous entry      Next entry

Team Flavor

  • Ran gel to confirm Valencene PCR: failed

  1. Ladder
  2. DNA 1-1
  3. DNA 1-2
  4. DNA 2-1
  5. DNA 2-2

The numerical differentiation refers to the specific genomic DNA sample

  • Ran PCR to extract J45004 and J45017 parts from the Wintergreen Pathway
   Primers: 
    J45004_F
    Left Primer: 5' cctttctagaatggaagttgttgaagttcttca 3'
    J45004_R
    Right Primer: 5' aaggctgcagcggccgctactagtttaatttattttggtcaagga 3' (last 5 bp omitted to meet 45 bp maximum)
    J45017_F
    Left Primer: 5' cctttctagaatgaaaactcccgaagactgc 3'
    J45017_R
    Right Primer: 5' aaggctgcagcggccgctactagtttattaggcgacgccgc 3' 


Personal tools