IGEM:Harvard/2009/Notebook/Harvard iGEM 2010/2010/07/28

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Team Flavor)
Line 26: Line 26:
     Right Primer: 5' aaggctgcagcggccgctactagtttattaggcgacgccgc 3'  
     Right Primer: 5' aaggctgcagcggccgctactagtttattaggcgacgccgc 3'  
The PCR reaction was set-up as per the specifications from the Phusion Polymerase manual (http://www.neb.com/nebecomm/ManualFiles/manualF-530.pdf).  For template DNA, 3.5 ng of the J45700 BioBrick part (the entire wintergreen pathway) was used.
<!-- ## Do not edit below this line unless you know what you are doing. ## -->
<!-- ## Do not edit below this line unless you know what you are doing. ## -->

Revision as of 13:43, 28 July 2010

iGEM iGarden Main project page
Previous entry      Next entry

Team Flavor

  • Ran gel to confirm Valencene PCR: failed

  1. Ladder
  2. DNA 1-1
  3. DNA 1-2
  4. DNA 2-1
  5. DNA 2-2

The numerical differentiation refers to the specific genomic DNA sample

  • Ran PCR to extract J45004 and J45017 parts from the Wintergreen Pathway
    Left Primer: 5' cctttctagaatggaagttgttgaagttcttca 3'
    Right Primer: 5' aaggctgcagcggccgctactagtttaatttattttggtcaagga 3' (last 5 bp omitted to meet 45 bp maximum)
    Left Primer: 5' cctttctagaatgaaaactcccgaagactgc 3'
    Right Primer: 5' aaggctgcagcggccgctactagtttattaggcgacgccgc 3' 

The PCR reaction was set-up as per the specifications from the Phusion Polymerase manual (http://www.neb.com/nebecomm/ManualFiles/manualF-530.pdf). For template DNA, 3.5 ng of the J45700 BioBrick part (the entire wintergreen pathway) was used.

Personal tools