IGEM:Harvard/2009/Notebook/Harvard iGEM 2010/2010/07/28: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 27: Line 27:
     Right Primer: 5' aaggctgcagcggccgctactagtttattaggcgacgccgc 3'  
     Right Primer: 5' aaggctgcagcggccgctactagtttattaggcgacgccgc 3'  


The PCR reaction was set-up as per the specifications from the Phusion Polymerase manual (http://www.neb.com/nebecomm/ManualFiles/manualF-530.pdf).  For template DNA, 3.5 ng of the J45700 BioBrick part (the entire wintergreen pathway) was used.
The PCR reaction was set-up as per the specifications from the Phusion Polymerase manual (http://www.neb.com/nebecomm/ManualFiles/manualF-530.pdf).  For template DNA, '''3.5 ng''' of the '''J45700''' BioBrick part (the entire wintergreen pathway) was used.


<!-- ## Do not edit below this line unless you know what you are doing. ## -->
<!-- ## Do not edit below this line unless you know what you are doing. ## -->

Revision as of 11:44, 28 July 2010

iGEM iGarden <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Team Flavor

  • Ran gel to confirm Valencene PCR: failed

  1. Ladder
  2. DNA 1-1
  3. DNA 1-2
  4. DNA 2-1
  5. DNA 2-2

The numerical differentiation refers to the specific genomic DNA sample

  • Ran PCR to extract J45004 and J45017 parts from the Wintergreen Pathway
   Primers: 
    J45004_F
    Left Primer: 5' cctttctagaatggaagttgttgaagttcttca 3'
    J45004_R
    Right Primer: 5' aaggctgcagcggccgctactagtttaatttattttggtcaagga 3' (last 5 bp omitted to meet 45 bp maximum)
    J45017_F
    Left Primer: 5' cctttctagaatgaaaactcccgaagactgc 3'
    J45017_R
    Right Primer: 5' aaggctgcagcggccgctactagtttattaggcgacgccgc 3'

The PCR reaction was set-up as per the specifications from the Phusion Polymerase manual (http://www.neb.com/nebecomm/ManualFiles/manualF-530.pdf). For template DNA, 3.5 ng of the J45700 BioBrick part (the entire wintergreen pathway) was used.


Retrieved from "https://openwetware.org/mediawiki/index.php?title=IGEM:Harvard/2009/Notebook/Harvard_iGEM_2010/2010/07/28&oldid=436964"