IGEM:Harvard/2009/Notebook/Harvard iGEM 2010/2010/07/28

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Team Flavor)
(Team Flavor)
Line 6: Line 6:
| colspan="2"|
| colspan="2"|
==Team Flavor==
==Team Flavor==
 +
===PCR Confirmation===
* Ran gel to confirm Valencene PCR: <font color="red">failed</font>
* Ran gel to confirm Valencene PCR: <font color="red">failed</font>
[[Image:ValPfxConfirm.jpg|240px]]
[[Image:ValPfxConfirm.jpg|240px]]
Line 16: Line 17:
''The numerical differentiation refers to the specific genomic DNA sample''
''The numerical differentiation refers to the specific genomic DNA sample''
 +
===PCR of Wintergreen parts===
* Ran PCR to extract J45004 and J45017 parts from the Wintergreen Pathway
* Ran PCR to extract J45004 and J45017 parts from the Wintergreen Pathway
Line 29: Line 31:
The PCR reaction was set-up as per the specifications from the Phusion Polymerase manual (http://www.neb.com/nebecomm/ManualFiles/manualF-530.pdf).  For template DNA, '''3.5 ng''' of the '''J45700''' BioBrick part (the entire wintergreen pathway) was used. <br/>
The PCR reaction was set-up as per the specifications from the Phusion Polymerase manual (http://www.neb.com/nebecomm/ManualFiles/manualF-530.pdf).  For template DNA, '''3.5 ng''' of the '''J45700''' BioBrick part (the entire wintergreen pathway) was used. <br/>
-
[[Image:PhusionDetails.png|240px]]
+
[[Image:PhusionDetails.png|240px]] [[Image:PhusionCycle.png|240px]]  

Revision as of 14:02, 28 July 2010

iGEM iGarden Main project page
Previous entry      Next entry

Team Flavor

PCR Confirmation

  • Ran gel to confirm Valencene PCR: failed

  1. Ladder
  2. DNA 1-1
  3. DNA 1-2
  4. DNA 2-1
  5. DNA 2-2
  6. Ladder

The numerical differentiation refers to the specific genomic DNA sample

PCR of Wintergreen parts

  • Ran PCR to extract J45004 and J45017 parts from the Wintergreen Pathway
   Primers: 
    J45004_F
    Left Primer: 5' cctttctagaatggaagttgttgaagttcttca 3'
    J45004_R
    Right Primer: 5' aaggctgcagcggccgctactagtttaatttattttggtcaagga 3' (last 5 bp omitted to meet 45 bp maximum)
    J45017_F
    Left Primer: 5' cctttctagaatgaaaactcccgaagactgc 3'
    J45017_R
    Right Primer: 5' aaggctgcagcggccgctactagtttattaggcgacgccgc 3' 

The PCR reaction was set-up as per the specifications from the Phusion Polymerase manual (http://www.neb.com/nebecomm/ManualFiles/manualF-530.pdf). For template DNA, 3.5 ng of the J45700 BioBrick part (the entire wintergreen pathway) was used.



Personal tools