IGEM:Harvard/2009/Notebook/Harvard iGEM 2010/2010/07/28: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
No edit summary |
|||
Line 33: | Line 33: | ||
[[Image:PhusionDetails.png|240px]] [[Image:PhusionCycle.png|240px]] <br/> | [[Image:PhusionDetails.png|240px]] [[Image:PhusionCycle.png|240px]] <br/> | ||
''An annealing temperature of 62°C for 15s was used. Polymerase was allowed to extend for 60s; Phusion Polymerase extends at 1kb/15s, our longest construct is 1.7 kb'' | ''An annealing temperature of 62°C for 15s was used. Polymerase was allowed to extend for 60s; Phusion Polymerase extends at 1kb/15s, our longest construct is 1.7 kb'' | ||
==Team Fence== | |||
===Minipreps=== | |||
===Barnase Digest Gel Extraction=== | |||
Success! | |||
[[Image:Barnase_pstxba_gel_ext_7-28.jpg]] | |||
<!-- ## Do not edit below this line unless you know what you are doing. ## --> | <!-- ## Do not edit below this line unless you know what you are doing. ## --> |
Revision as of 16:05, 28 July 2010
iGEM iGarden | <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page <html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html> </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html> |
Team FlavorPCR Confirmation
The numerical differentiation refers to the specific genomic DNA sample PCR of Wintergreen parts
Primers: J45004_F Left Primer: 5' cctttctagaatggaagttgttgaagttcttca 3' J45004_R Right Primer: 5' aaggctgcagcggccgctactagtttaatttattttggtcaagga 3' (last 5 bp omitted to meet 45 bp maximum) J45017_F Left Primer: 5' cctttctagaatgaaaactcccgaagactgc 3' J45017_R Right Primer: 5' aaggctgcagcggccgctactagtttattaggcgacgccgc 3' The PCR reaction was set-up as per the specifications from the Phusion Polymerase manual (http://www.neb.com/nebecomm/ManualFiles/manualF-530.pdf). For template DNA, 3.5 ng of the J45700 BioBrick part (the entire wintergreen pathway) was used. Team FenceMiniprepsBarnase Digest Gel Extraction |