IGEM:Harvard/2009/Notebook/Harvard iGEM 2010/2010/07/28

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(PCR of Wintergreen parts)
Line 33: Line 33:
[[Image:PhusionDetails.png|240px]] [[Image:PhusionCycle.png|240px]] <br/>
[[Image:PhusionDetails.png|240px]] [[Image:PhusionCycle.png|240px]] <br/>
''An annealing temperature of 62°C for 15s was used.  Polymerase was allowed to extend for 60s; Phusion Polymerase extends at 1kb/15s, our longest construct is 1.7 kb''
''An annealing temperature of 62°C for 15s was used.  Polymerase was allowed to extend for 60s; Phusion Polymerase extends at 1kb/15s, our longest construct is 1.7 kb''
 +
 +
''PCR Confirmation''
 +
[[Image:004017PCRconfirm.jpg|240px]]
 +
 +
#Ladder
 +
#J45004 PCR 1
 +
#J45004 PCR 2
 +
#J45017 PCR 1
 +
#J45017 PCR 2
 +
#Ladder
==Team Fence==
==Team Fence==

Revision as of 09:33, 29 July 2010

iGEM iGarden Main project page
Previous entry      Next entry

Team Flavor

PCR Confirmation

  • Ran gel to confirm Valencene PCR: failed

  1. Ladder
  2. DNA 1-1
  3. DNA 1-2
  4. DNA 2-1
  5. DNA 2-2
  6. Ladder

The numerical differentiation refers to the specific genomic DNA sample

PCR of Wintergreen parts

  • Ran PCR to extract J45004 and J45017 parts from the Wintergreen Pathway
   Primers: 
    J45004_F
    Left Primer: 5' cctttctagaatggaagttgttgaagttcttca 3'
    J45004_R
    Right Primer: 5' aaggctgcagcggccgctactagtttaatttattttggtcaagga 3' (last 5 bp omitted to meet 45 bp maximum)
    J45017_F
    Left Primer: 5' cctttctagaatgaaaactcccgaagactgc 3'
    J45017_R
    Right Primer: 5' aaggctgcagcggccgctactagtttattaggcgacgccgc 3' 

The PCR reaction was set-up as per the specifications from the Phusion Polymerase manual (http://www.neb.com/nebecomm/ManualFiles/manualF-530.pdf). For template DNA, 3.5 ng of the J45700 BioBrick part (the entire wintergreen pathway) was used.

An annealing temperature of 62°C for 15s was used. Polymerase was allowed to extend for 60s; Phusion Polymerase extends at 1kb/15s, our longest construct is 1.7 kb

PCR Confirmation

  1. Ladder
  2. J45004 PCR 1
  3. J45004 PCR 2
  4. J45017 PCR 1
  5. J45017 PCR 2
  6. Ladder

Team Fence

Minipreps

Barnase Digest Gel Extraction

Success! Image:Barnase_pstxba_gel_ext_7-28.jpg


Personal tools