IGEM:Harvard/2009/Notebook/Harvard iGEM 2010/2010/07/28

Team Flavor

PCR Confirmation

• Ran gel to confirm Valencene PCR: failed

1. Ladder
2. DNA 1-1
3. DNA 1-2
4. DNA 2-1
5. DNA 2-2
6. Ladder

The numerical differentiation refers to the specific genomic DNA sample

PCR of Wintergreen parts

• Ran PCR to extract J45004 and J45017 parts from the Wintergreen Pathway

   Primers: 
    J45004_F
    Left Primer: 5' cctttctagaatggaagttgttgaagttcttca 3'
    J45004_R
    Right Primer: 5' aaggctgcagcggccgctactagtttaatttattttggtcaagga 3' (last 5 bp omitted to meet 45 bp maximum)
    J45017_F
    Left Primer: 5' cctttctagaatgaaaactcccgaagactgc 3'
    J45017_R
    Right Primer: 5' aaggctgcagcggccgctactagtttattaggcgacgccgc 3' 

The PCR reaction was set-up as per the specifications from the Phusion Polymerase manual (http://www.neb.com/nebecomm/ManualFiles/manualF-530.pdf). For template DNA, 3.5 ng of the J45700 BioBrick part (the entire wintergreen pathway) was used.

An annealing temperature of 62°C for 15s was used. Polymerase was allowed to extend for 60s; Phusion Polymerase extends at 1kb/15s, our longest construct is 1.7 kb

PCR Confirmation

1. Ladder
2. J45004 PCR #1
3. J45004 PCR #2
4. J45017 PCR #1
5. J45017 PCR #2
6. Ladder

Team Fence

Minipreps

Barnase Digest Gel Extraction

Success!