IGEM:Harvard/2009/Notebook/Harvard iGEM 2010/2010/07/28

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Team Allergy)
Line 6: Line 6:
| colspan="2"|
| colspan="2"|
==Team Allergy==
==Team Allergy==
 +
 +
Yesterday, we plated E. coli containing complete hpRNA for Ger, Bet v2, and LTP. Bet v1 did not ligate properly in the earlier Sense+Intron ligation.
 +
 +
Today, we will extract the plasmids from the E. coli and prepare them for sequencing tomorrow.
 +
*Grew up colonies to miniprep (Complete Ger, Bet2, LTP parts)
*Grew up colonies to miniprep (Complete Ger, Bet2, LTP parts)
**''Concentrations''
**''Concentrations''
*Transformed more sense+pdk parts for our false negatives (16,30,31)
*Transformed more sense+pdk parts for our false negatives (16,30,31)
 +
==Team Flavor==
==Team Flavor==
===PCR Confirmation===
===PCR Confirmation===

Revision as of 13:46, 30 July 2010

iGEM iGarden Main project page
Previous entry      Next entry

Team Allergy

Yesterday, we plated E. coli containing complete hpRNA for Ger, Bet v2, and LTP. Bet v1 did not ligate properly in the earlier Sense+Intron ligation.

Today, we will extract the plasmids from the E. coli and prepare them for sequencing tomorrow.

  • Grew up colonies to miniprep (Complete Ger, Bet2, LTP parts)
    • Concentrations
  • Transformed more sense+pdk parts for our false negatives (16,30,31)

Team Flavor

PCR Confirmation

  • Ran gel to confirm Valencene PCR: failed

  1. Ladder
  2. DNA 1-1
  3. DNA 1-2
  4. DNA 2-1
  5. DNA 2-2
  6. Ladder

The numerical differentiation refers to the specific genomic DNA sample

PCR of Wintergreen parts

  • Ran PCR to extract J45004 and J45017 parts from the Wintergreen Pathway
   Primers: 
    J45004_F
    Left Primer: 5' cctttctagaatggaagttgttgaagttcttca 3'
    J45004_R
    Right Primer: 5' aaggctgcagcggccgctactagtttaatttattttggtcaagga 3' (last 5 bp omitted to meet 45 bp maximum)
    J45017_F
    Left Primer: 5' cctttctagaatgaaaactcccgaagactgc 3'
    J45017_R
    Right Primer: 5' aaggctgcagcggccgctactagtttattaggcgacgccgc 3' 

The PCR reaction was set-up as per the specifications from the Phusion Polymerase manual (http://www.neb.com/nebecomm/ManualFiles/manualF-530.pdf). For template DNA, 3.5 ng of the J45700 BioBrick part (the entire wintergreen pathway) was used.

An annealing temperature of 62°C for 15s was used. Polymerase was allowed to extend for 60s; Phusion Polymerase extends at 1kb/15s, our longest construct is 1.7 kb

PCR Confirmation

  1. Ladder
  2. J45004 PCR #1
  3. J45004 PCR #2
  4. J45017 PCR #1
  5. J45017 PCR #2
  6. Ladder
  • Both J45004 PCR reactions appear to have worked, with product at the expected size of 1.1 kb.
  • The J45017 PCR reactions appears to have amplified some of the wrong sequence, as suggested by the short DNA fragment. However, the longer ~2 kb fragment in PCR #1 does appear to be around the correct length.

Team Fence

Minipreps

Barnase Digest Gel Extraction

Success! Image:Barnase_pstxba_gel_ext_7-28.jpg


Personal tools