IGEM:Harvard/2009/Notebook/Harvard iGEM 2010/2010/07/28

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Team Allergy)
(Team Allergy)
Line 6: Line 6:
| colspan="2"|
| colspan="2"|
==Team Allergy==
==Team Allergy==
 +
===Protocol===
Yesterday, we plated E. coli containing complete hpRNA for Ger, Bet v2, and LTP. Bet v1 did not ligate properly in the earlier Sense+Intron ligation.  
Yesterday, we plated E. coli containing complete hpRNA for Ger, Bet v2, and LTP. Bet v1 did not ligate properly in the earlier Sense+Intron ligation.  
-
Today, we will extract the plasmids from the E. coli and prepare them for sequencing tomorrow.  
+
Today, we will extract the plasmids from the E. coli and prepare them for sequencing tomorrow. We will also do ligations with the false negatives (Sense + PDK ligate with Antisense).  
-
*Grew up colonies to miniprep (Complete Ger, Bet2, LTP parts)
+
#Culture colonies  
-
**''Concentrations''
+
#Miniprep
 +
#Nanodrop
 +
#Digest false negatives
 +
#Ligate
 +
#Transform
 +
 
 +
===Results===
 +
 
 +
'''Nanodrop'''
 +
 
 +
The format is: Miniprep # , Name of Allergen, concentration in ng/μL of colony 1, concentration in ng/μL of colony 2.
 +
All these working ligations are with the PAL intron
 +
 
 +
#9, LTP, 97.9, 94.1
 +
#11, LTP, 77.9, 94.8
 +
#25, Bet v2, 67.8, 97.8 (there was a mixup with colony 1 and LTP+PDK, but it is now fixed in our electronic notebooks)
 +
#28, Bet v2, 73.2, 83.6
 +
#36, Ger3, 76.1, 83.4
 +
#37, Ger3, 70.0, 75.3
 +
#38, Ger3, 90.4, 108.3
*Transformed more sense+pdk parts for our false negatives (16,30,31)
*Transformed more sense+pdk parts for our false negatives (16,30,31)

Revision as of 15:02, 30 July 2010

iGEM iGarden Main project page
Previous entry      Next entry

Team Allergy

Protocol

Yesterday, we plated E. coli containing complete hpRNA for Ger, Bet v2, and LTP. Bet v1 did not ligate properly in the earlier Sense+Intron ligation.

Today, we will extract the plasmids from the E. coli and prepare them for sequencing tomorrow. We will also do ligations with the false negatives (Sense + PDK ligate with Antisense).

  1. Culture colonies
  2. Miniprep
  3. Nanodrop
  4. Digest false negatives
  5. Ligate
  6. Transform

Results

Nanodrop

The format is: Miniprep # , Name of Allergen, concentration in ng/μL of colony 1, concentration in ng/μL of colony 2. All these working ligations are with the PAL intron

  1. 9, LTP, 97.9, 94.1
  2. 11, LTP, 77.9, 94.8
  3. 25, Bet v2, 67.8, 97.8 (there was a mixup with colony 1 and LTP+PDK, but it is now fixed in our electronic notebooks)
  4. 28, Bet v2, 73.2, 83.6
  5. 36, Ger3, 76.1, 83.4
  6. 37, Ger3, 70.0, 75.3
  7. 38, Ger3, 90.4, 108.3
  • Transformed more sense+pdk parts for our false negatives (16,30,31)

Team Flavor

PCR Confirmation

  • Ran gel to confirm Valencene PCR: failed

  1. Ladder
  2. DNA 1-1
  3. DNA 1-2
  4. DNA 2-1
  5. DNA 2-2
  6. Ladder

The numerical differentiation refers to the specific genomic DNA sample

PCR of Wintergreen parts

  • Ran PCR to extract J45004 and J45017 parts from the Wintergreen Pathway
   Primers: 
    J45004_F
    Left Primer: 5' cctttctagaatggaagttgttgaagttcttca 3'
    J45004_R
    Right Primer: 5' aaggctgcagcggccgctactagtttaatttattttggtcaagga 3' (last 5 bp omitted to meet 45 bp maximum)
    J45017_F
    Left Primer: 5' cctttctagaatgaaaactcccgaagactgc 3'
    J45017_R
    Right Primer: 5' aaggctgcagcggccgctactagtttattaggcgacgccgc 3' 

The PCR reaction was set-up as per the specifications from the Phusion Polymerase manual (http://www.neb.com/nebecomm/ManualFiles/manualF-530.pdf). For template DNA, 3.5 ng of the J45700 BioBrick part (the entire wintergreen pathway) was used.

An annealing temperature of 62°C for 15s was used. Polymerase was allowed to extend for 60s; Phusion Polymerase extends at 1kb/15s, our longest construct is 1.7 kb

PCR Confirmation

  1. Ladder
  2. J45004 PCR #1
  3. J45004 PCR #2
  4. J45017 PCR #1
  5. J45017 PCR #2
  6. Ladder
  • Both J45004 PCR reactions appear to have worked, with product at the expected size of 1.1 kb.
  • The J45017 PCR reactions appears to have amplified some of the wrong sequence, as suggested by the short DNA fragment. However, the longer ~2 kb fragment in PCR #1 does appear to be around the correct length.

Team Fence

Minipreps

Barnase Digest Gel Extraction

Success! Image:Barnase_pstxba_gel_ext_7-28.jpg


Personal tools