IGEM:Harvard/2009/Notebook/Harvard iGEM 2010/2010/07/28: Difference between revisions
m (→Results) |
|||
Line 34: | Line 34: | ||
#38, Ger3, 90.4, 108.3 | #38, Ger3, 90.4, 108.3 | ||
'''Transformed more sense+pdk parts for our false negatives (16,30,31)''' | |||
The parts already have been digested and purified, so today, all we had to do was ligate and transform. | |||
==Team Flavor== | ==Team Flavor== |
Revision as of 12:03, 30 July 2010
iGEM iGarden | <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page <html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html> </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html> |
Team AllergyProtocolYesterday, we plated E. coli containing complete hpRNA for Ger, Bet v2, and LTP. Bet v1 did not ligate properly in the earlier Sense+Intron ligation. Today, we will extract the plasmids from the E. coli and prepare them for sequencing tomorrow. We will also do ligations with the false negatives (Sense + PDK ligate with Antisense).
ResultsNanodrop The format is: Miniprep # , Name of Allergen, concentration in ng/μL of colony 1, concentration in ng/μL of colony 2. All these working ligations are with the PAL intron
Transformed more sense+pdk parts for our false negatives (16,30,31) The parts already have been digested and purified, so today, all we had to do was ligate and transform. Team FlavorPCR Confirmation
The numerical differentiation refers to the specific genomic DNA sample PCR of Wintergreen parts
Primers: J45004_F Left Primer: 5' cctttctagaatggaagttgttgaagttcttca 3' J45004_R Right Primer: 5' aaggctgcagcggccgctactagtttaatttattttggtcaagga 3' (last 5 bp omitted to meet 45 bp maximum) J45017_F Left Primer: 5' cctttctagaatgaaaactcccgaagactgc 3' J45017_R Right Primer: 5' aaggctgcagcggccgctactagtttattaggcgacgccgc 3' The PCR reaction was set-up as per the specifications from the Phusion Polymerase manual (http://www.neb.com/nebecomm/ManualFiles/manualF-530.pdf). For template DNA, 3.5 ng of the J45700 BioBrick part (the entire wintergreen pathway) was used.
Team FenceMiniprepsBarnase Digest Gel Extraction |