IGEM:Harvard/2009/Notebook/Harvard iGEM 2010/2010/07/28
From OpenWetWare
iGEM iGarden | <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page <html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html> </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html> |
Team FlavorPCR Confirmation
The numerical differentiation refers to the specific genomic DNA sample PCR of Wintergreen parts
Primers: J45004_F Left Primer: 5' cctttctagaatggaagttgttgaagttcttca 3' J45004_R Right Primer: 5' aaggctgcagcggccgctactagtttaatttattttggtcaagga 3' (last 5 bp omitted to meet 45 bp maximum) J45017_F Left Primer: 5' cctttctagaatgaaaactcccgaagactgc 3' J45017_R Right Primer: 5' aaggctgcagcggccgctactagtttattaggcgacgccgc 3' The PCR reaction was set-up as per the specifications from the Phusion Polymerase manual (http://www.neb.com/nebecomm/ManualFiles/manualF-530.pdf). For template DNA, 3.5 ng of the J45700 BioBrick part (the entire wintergreen pathway) was used. |