IGEM:Harvard/2009/Notebook/Harvard iGEM 2010/2010/07/28

From OpenWetWare
Jump to navigationJump to search
iGEM iGarden <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Team Allergy

Yesterday, we plated E. coli containing complete hpRNA for Ger, Bet v2, and LTP. Bet v1 did not ligate properly in the earlier Sense+Intron ligation.

Today, we will extract the plasmids from the E. coli and prepare them for sequencing tomorrow.

  • Grew up colonies to miniprep (Complete Ger, Bet2, LTP parts)
    • Concentrations
  • Transformed more sense+pdk parts for our false negatives (16,30,31)

Team Flavor

PCR Confirmation

  • Ran gel to confirm Valencene PCR: failed

  1. Ladder
  2. DNA 1-1
  3. DNA 1-2
  4. DNA 2-1
  5. DNA 2-2
  6. Ladder

The numerical differentiation refers to the specific genomic DNA sample

PCR of Wintergreen parts

  • Ran PCR to extract J45004 and J45017 parts from the Wintergreen Pathway
   Primers: 
    J45004_F
    Left Primer: 5' cctttctagaatggaagttgttgaagttcttca 3'
    J45004_R
    Right Primer: 5' aaggctgcagcggccgctactagtttaatttattttggtcaagga 3' (last 5 bp omitted to meet 45 bp maximum)
    J45017_F
    Left Primer: 5' cctttctagaatgaaaactcccgaagactgc 3'
    J45017_R
    Right Primer: 5' aaggctgcagcggccgctactagtttattaggcgacgccgc 3'

The PCR reaction was set-up as per the specifications from the Phusion Polymerase manual (http://www.neb.com/nebecomm/ManualFiles/manualF-530.pdf). For template DNA, 3.5 ng of the J45700 BioBrick part (the entire wintergreen pathway) was used.

An annealing temperature of 62°C for 15s was used. Polymerase was allowed to extend for 60s; Phusion Polymerase extends at 1kb/15s, our longest construct is 1.7 kb

PCR Confirmation

  1. Ladder
  2. J45004 PCR #1
  3. J45004 PCR #2
  4. J45017 PCR #1
  5. J45017 PCR #2
  6. Ladder
  • Both J45004 PCR reactions appear to have worked, with product at the expected size of 1.1 kb.
  • The J45017 PCR reactions appears to have amplified some of the wrong sequence, as suggested by the short DNA fragment. However, the longer ~2 kb fragment in PCR #1 does appear to be around the correct length.

Team Fence

Minipreps

Barnase Digest Gel Extraction

Success!


Retrieved from "https://openwetware.org/mediawiki/index.php?title=IGEM:Harvard/2009/Notebook/Harvard_iGEM_2010/2010/07/28&oldid=437958"