IGEM:Harvard/2010/Team Allergy

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Primers and Sequences)
Line 46: Line 46:
|pdk intron
|pdk intron
|''CCTTGAATTCGCGGCCGCATCTAGA'' tcttttttccttttagtata

Revision as of 14:24, 17 June 2010



Allergies to fruits and vegetables are (increasingly) common, affecting millions of people around the world with symptoms ranging from mild itchiness to life-threatening anaphylaxis. Allergy is caused by an inappropriate immune response to harmless proteins present in the environment. Several common food allergens are structurally similar to pollens that cause seasonal allergies and are present in a wide range of fruits and vegetables. Many of these proteins have been knocked down in plants using RNA interference, leading to plants with reduced allergenicity. As part of our iGarden project we are designing modular BioBrick intron-containing self-complementary hairpin forming RNA (ihpRNA) constructs for the targeted knockdown of proteins with homology to allergens in arabidopsis and strawberry, as well as designing ihpRNA constructs against allergens in a range of other plants common in home gardens, including lettuce, carrots, celery, tomato, and several herbs. Our goal is to use genetic engineering to make food safer, and to specially tailor gardens to the needs of each person with a different set of allergies.


Plant shRNA

  1. Wesley SV, Helliwell CA, Smith NA, Wang MB, Rouse DT, Liu Q, Gooding PS, Singh SP, Abbott D, Stoutjesdijk PA, Robinson SP, Gleave AP, Green AG, and Waterhouse PM. . pmid:11576441. PubMed HubMed [1]
  2. Schwab R, Ossowski S, Riester M, Warthmann N, and Weigel D. . pmid:16531494. PubMed HubMed [2]
All Medline abstracts: PubMed HubMed

Allergen silencing

  1. Dodo HW, Konan KN, Chen FC, Egnin M, and Viquez OM. . pmid:17784907. PubMed HubMed [3]
  2. Singh MB and Bhalla PL. . pmid:18467156. PubMed HubMed [4]
  3. Le LQ, Mahler V, Lorenz Y, Scheurer S, Biemelt S, Vieths S, and Sonnewald U. . pmid:17088146. PubMed HubMed [5]
  4. Gallo M and Sayre R. . pmid:19356919. PubMed HubMed [6]
  5. Lorenz Y, Enrique E, Lequynh L, Fötisch K, Retzek M, Biemelt S, Sonnewald U, Vieths S, and Scheurer S. . pmid:16950292. PubMed HubMed [7]
  6. Herman EM, Helm RM, Jung R, and Kinney AJ. . pmid:12746509. PubMed HubMed [8]
  7. Gilissen LJ, Bolhaar ST, Matos CI, Rouwendal GJ, Boone MJ, Krens FA, Zuidmeer L, Van Leeuwen A, Akkerdaas J, Hoffmann-Sommergruber K, Knulst AC, Bosch D, Van de Weg WE, and Van Ree R. . pmid:15696096. PubMed HubMed [9]
  8. Bhalla PL and Singh MB. . pmid:14962769. PubMed HubMed [10]
All Medline abstracts: PubMed HubMed

Allergen proteins

  1. Chardin H, Mayer C, Sénéchal H, Wal JM, Poncet P, Desvaux FX, and Peltre G. . pmid:12811016. PubMed HubMed [11]
  2. San Miguel-Moncín M, Krail M, Scheurer S, Enrique E, Alonso R, Conti A, Cisteró-Bahíma A, and Vieths S. . pmid:12757453. PubMed HubMed [12]
  3. Salcedo G, Sanchez-Monge R, Diaz-Perales A, Garcia-Casado G, and Barber D. . pmid:15347364. PubMed HubMed [13]
  4. Gajhede M, Osmark P, Poulsen FM, Ipsen H, Larsen JN, Joost van Neerven RJ, Schou C, Løwenstein H, and Spangfort MD. . pmid:8946858. PubMed HubMed [14]
  5. Zuidmeer L, Salentijn E, Rivas MF, Mancebo EG, Asero R, Matos CI, Pelgrom KT, Gilissen LJ, and van Ree R. . pmid:16650053. PubMed HubMed [15]
  6. Karlsson AL, Alm R, Ekstrand B, Fjelkner-Modig S, Schiött A, Bengtsson U, Björk L, Hjernø K, Roepstorff P, and Emanuelsson CS. . pmid:15507096. PubMed HubMed [16]
  7. Musidlowska-Persson A, Alm R, and Emanuelsson C. . pmid:16945416. PubMed HubMed [17]
  8. Breiteneder H and Ebner C. . pmid:10887301. PubMed HubMed [18]
  9. Jensen-Jarolim E, Schmid B, Bernier F, Berna A, Kinaciyan T, Focke M, Ebner C, Scheiner O, and Boltz-Nitulescu G. . pmid:12169176. PubMed HubMed [19]
All Medline abstracts: PubMed HubMed

Primers and Sequences

name GenBank Accession forward sense primer reverse sense primer forward antisense primer reverse antisense primer


Isolating Genes From Plants

Strawberry Transformation

  1. Schaart JG, Krens FA, Pelgrom KT, Mendes O, and Rouwendal GJ. . pmid:17147614. PubMed HubMed [1]
  2. Oosumi T, Gruszewski HA, Blischak LA, Baxter AJ, Wadl PA, Shuman JL, Veilleux RE, and Shulaev V. . pmid:16320068. PubMed HubMed [2]
  3. Husaini AM. . pmid:19956955. PubMed HubMed [3]
  4. Graham J, McNicol RJ, and Kumar A. . pmid:7581659. PubMed HubMed [4]
All Medline abstracts: PubMed HubMed


Personal tools