IGEM:Harvard/2010/Team Allergy

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Protocols)
(Introns)
Line 190: Line 190:
==Introns==
==Introns==
-
ihpRNA production requires the selection of an intron. Here's one (between || in the range 295..396): [http://www.ncbi.nlm.nih.gov/nuccore/D64156.1 D64156.1]
+
ihpRNA production requires the selection of an intron. We are using PCR to make hairpin parts out of two introns:
-
<pre>
+
*[http://www.ncbi.nlm.nih.gov/nuccore/2895509 PME3, 746bp]
-
        1 tgtagtaatg tgtatatata ggtggtcgtg ttacgcgagg aggaacacag caaactcatc
+
*[http://www.ncbi.nlm.nih.gov/nuccore/497420 PAL2, 240bp]
-
      61 aaatctgggg ttgacaagaa tctggtactg tctacaagca atagttatta ctccccaaag
+
-
      121 gtgtggttgg tgggggatgg aatagagaac gaagagcaga tgaaagcaaa agaaggaacc
+
-
      181 ctctttgttc ccttttctca ctttccgccc aacaaactcc gcaaggactg tttctaccag
+
-
      241 tccactccag ctatgcgtgt tcccaagtct gcccaaaaca tcgactcctg tgag|gtacat
+
-
      301 ctttgaattc ttatagatat atctgtaact tttatattat ataagctgat agatgtgttc
+
-
      361 atctataatg aatgaatggt tgttatatat atatag|aact ggctggggag gagggtgatg
+
-
      421 agtgcatgga aaataggagg tatagtgcat gcacttgagg gttgggagga gcatgactgc
+
-
      481 ggcaacactt gcaacgtcct ccgtctccac gccatatggg aagctgctct tcgccatgat
+
-
      541 ttccaacctc tcccaccatc tcctctatga gcttttttca tattcataca tctatgtccc
+
-
      601 ct
+
-
</pre>
+
-
*[http://www.ncbi.nlm.nih.gov/nuccore/L33679.1 PAL 3] intron 2303-2992
+
-
<pre>
+
-
  1 ttttatctat ctttttattt tcttgtgtgg attgcttgtg attttgtttg ttggcctaat
+
-
      61 aatcagcttg gattttttag ctttcttgga aataaaagaa gatcacgata attaattact
+
-
      121 ttatggtccc aacctacaaa ttgttggact actattggaa ctaacaaata aatacacgaa
+
-
      181 attgattggg tgagttataa tattaccttt ttagtttttg atatagtcaa attttatagt
+
-
      241 ataacagatt tgttaaaatt aaattgtatc gaaacttctt atagtaatgt actaatgtga
+
-
      301 gaaaatctgt gtactgttat tatagtatac gcgttttaat acttttatta ttattcctac
+
-
      361 ttaaagaaaa taccaaatat ttttccgttt tttgggtgtg tttagttctt ttttttttaa
+
-
      421 ctgaaggatt ttggtgaatt ttctgttgcc attaaaaata tttgtgttta gttttttgat
+
-
      481 attttaattc tttacttttt tttaagataa tcaatgwwgg accaacatcc caaatgtgaa
+
-
      541 ccaaactccg acccgaaanc cgctgctttc aatactttca atcgaaatag cgtgtgacgt
+
-
      601 gtgttaatat ctgcatgcat tgattatcgg acaatgacaa atattctatt tatcctaaat
+
-
      661 tttattctcc gtgaagtaca catttggaca aaccaaacgt agatttgaga aaaaaatgcg
+
-
      721 gaaaacccaa agtctatccg tggcgaagaa taagaggcaa aaacggggaa tataacccaa
+
-
      781 agtctaaacc caataattat tttattgata atcaaaatct atcacgagaa agacgacgtt
+
-
      841 ttgacatctc agtcgttata aatttcaata aattatgttt cccttgaact gattcacatg
+
-
      901 tcattttcat tccacatata tacgccaatc gtgtaatctt ttagattatc gatcgaacat
+
-
      961 ctaaattttg tcaacatgtt aatgaatatc taaggaacgc tatcgsstat cgcttttttc
+
-
    1021 aacataagtc taatttgaga gatgttaatc caccgcatgt tgagtggtgt aagagagaaa
+
-
    1081 gagccgccac taggctactt gtctcccaac aacaatatat atcctgaatt atgaattatg
+
-
    1141 caattatact tttctggtca ttcaattatt attacttttg ttttgttcaa aatgctttag
+
-
    1201 tgtactactt tcaaatttca acatccttct ttatttattt caactttttt ctcaacatta
+
-
    1261 tcgtttcttt tttsctgtcg ataacaacaa cttgttgagt gtcttgcaaa gattagcctt
+
-
    1321 ttactcgatt ccccgtttga ttagatttta aggctttccg ttaaccttta acagttaaca
+
-
    1381 aagtgtggag tgcctagcaa agacaattgt gctttgtkky ggcggcaacg tcagcaacgr
+
-
    1441 ttttaggact tctacttctg atgagagata cagakcgttg ccwygttgaa aaagaaatta
+
-
    1501 aaaggaaaac ataacacatt atacgagaaa gaagtttaaa aaaaaaaaaa actggttgaa
+
-
    1561 actaatcgaa tatttgaagc attttttata tctactagaa agtaagtttt ttaatggcta
+
-
    1621 aaaacgaata atcctattca ttattttaar tcaaacacta ataagatgtt cttaaacatt
+
-
    1681 tcaactagtt aaccccattg ttttccctct atatatatac cccaccaagg cacaaaccaa
+
-
    1741 cccactcact cacattattt aaaacacatg ttttactact tgtctacata tatctatata
+
-
    1801 atcatcgtag aaatcgatac ttgaggccag cccaaaatca cactcgagtc gaatatatat
+
-
    1861 atatatatat atatcttaat ccggctcgtt atataaaagc tccagacttg tcactagggt
+
-
    1921 tgccgtcaga ttttgtgatc atggagtttc gtcaaccaaa cgcaacagca ttgagcgacc
+
-
    1981 cacttaactg gaatgtagcg gcggaggctt taaaagggag ccacctggag gaggtgaaga
+
-
    2041 agatggtgaa ggattatagg aaaggaacgg tgcagctagg cggagagacg ctgaccatcg
+
-
    2101 gtcaggttgc ggcagtagcg agtggaggag gaccgacagt ggagctttct gaggaggctc
+
-
    2161 ggggcggtgt gaaggcgagt agtgactggg tgatggagag catgaaccgt gatacggaca
+
-
    2221 catatgggat caccactgga tttggttcat cttctcgtag gaggactgac caaggtgctg
+
-
    2281 ctcttcaaaa agagcttatt aggtaatt|ca tattcatagt tgaatcagac gaaaaataaa
+
-
    2341 tagaatcata gaaaactagg tttagaaacc cgtacataaa ctagtttttt taaaaaggaa
+
-
    2401 tssatattta tatccagcgc ctatagataa agaacaagac attttataat ctgtctcgac
+
-
    2461 gtttttacac caacaaatga gaataattag tcgtactata aaagttcaaa tttctttaaa
+
-
    2521 tatgattaaa cgaagactaa aacgctctaa gttttactac atttttaaat aaatacgact
+
-
    2581 ttttgccgaa agaaaacata gtacttaaga taagagcatt ttgtgttcta atgaaaatta
+
-
    2641 aacgtttctg cattctctat tcttttgact gtcttatact tttattgaaa taagcttttt
+
-
    2701 ttaacttttg taaatcagct ttaacgaaaa aagaatgtag tgactagtgg agcacggagg
+
-
    2761 caaagttgct agctttgtac accttttttt tatttttgtc ttttgggttg taacttagat
+
-
    2821 aagaagaggt ctcagtccgt aaaaagttta aacggtatcg attaaaattg tttaagctaa
+
-
    2881 aagaggtagt agtcgaagtt attaaatgca ttatattata tagttgacaa aagtaattaa
+
-
    2941 aaaataaatg taatcggttt aaaactgacg gatcccaaat tatatcaacc ag|gtatttga
+
-
    3001 acgccgggat attcgctacc ggcaacgaag atgacgacag gtcaaacacg cttccccggc
+
-
    3061 cggctactag agcagcgatg ctcatccgtg taaacaccct cctccaaggc tactctggta
+
-
    3121 tacgctttga gatcctcgaa gccatcacaa cactcctcaa ctgcaaaatt acaccgctcc
+
-
    3181 ttcctctccg aggcaccatt accgcctccg gggatctcgt tccgttatcc tatatcgctg
+
-
    3241 gattcctcat cgggcgcccc aactcccgat ccgtgggccc ctctggcgag atcctcactg
+
-
    3301 ccttggaggc cttcaagctc gctggagtat cgtctttttt cgaactcagg cctaaagaag
+
-
    3361 ggcttgcgct cgtgaatggg actgcggtgg ggtctgcttt agcctctacg gtactgtacg
+
-
    3421 atgccaacat tttggtggtt ttctccgaag ttgcttccgc catgtttgca gaggttatgc
+
-
    3481 aggggaaacc agagtttacc gatcatctta cgcataaact caagcaccat cctggtcaga
+
-
    3541 tcgaagccgc cgctatcatg gagcatattc tagacggaag ctcttatgta aaagaagctc
+
-
    3601 tacatctcca caagattgat ccgcttcaga aacctaaaca agatcggtat gttcttgggt
+
-
    3661 atcaagcaac tagtttcttg taactcaagt aacccttttg atttgctttc tgattaaatt
+
-
    3721 gacttatagt ttcgtgttta aattaacagt tacgctctgc gaacatctcc gcaatggctt
+
-
    3781 ggaccgcaga ttgaggtgat aagagcagcg actaagatga tcgaacgtga gataaactca
+
-
    3841 gtaaacgata accctttgat cgatgtttca agaaacaaag ctatccatgg tgggaacttc
+
-
    3901 caggggacac caattggtgt cgccatggat aacactcgtc tagcacttgc ttctatcggg
+
-
    3961 aagctaatgt tcgctcagtt cactgaactc gtaaatgatt tctacaacaa cgggttaccc
+
-
    4021 tctaatctat ctggtggtag aaaccctagt cttgattacg ggttaaaagg cgcagaagtc
+
-
    4081 gccatggctt cttattgctc agagcttcag ttcctagcaa atcctgtgac gaaccatgtc
+
-
    4141 gaaagcgctt ctcaacacaa tcaagatgtt aactctcttg ggctgatctc gagccgaacg
+
-
    4201 acagcagaag ctgtggttat cctcaagctc atgtcaacga cttacttggt agctttgtgc
+
-
    4261 caagcctttg atctgagaca ccttgaagaa attctcaaga aagcggttaa tgaggttgtg
+
-
    4321 agccacactg ccaaaagcgt tctagcaatc gaaccattcc gcaaacacga cgatattctt
+
-
    4381 ggagttgtca accgcgaata cgtcttctcc tatgttgatg acccaagcag cctcactaac
+
-
    4441 cctttaatgc agaagctgag acatgtcctc ttcgacaaag ctttagctga accggaaggc
+
-
    4501 gagaccgaca cggtttttcg gaaaatcgga gcgttcgagg ccgagctgaa atttctcctc
+
-
    4561 cctaaagaag tggaacgagt caggacagag tacgagaacg gtacatttaa tgtggctaac
+
-
    4621 cgaatcaaga agtgtcgatc gtatccgctg taccggtttg tgcggaatga actcgagacg
+
-
    4681 aggttgctaa ccggagagga tgttcggtca ccgggagagg attttgacaa agtcttcagg
+
-
    4741 gctatatctc aaggaaaact catagawcct ctgtttgaat gtctgaaaga gtggaacggt
+
-
    4801 gctccgattt ctatctgcta aaacgtttcg tcagatctcc atatatcgag aataataaac
+
-
    4861 acaccattcg aaaatatttg gttgtgtagt aatcgtcttg ccttcgcctt ttcaataatg
+
-
    4921 tcctg
+
-
</pre>
+

Revision as of 10:24, 22 June 2010

Contents

Description

Allergies to fruits and vegetables are (increasingly) common, affecting millions of people around the world with symptoms ranging from mild itchiness to life-threatening anaphylaxis. Allergy is caused by an inappropriate immune response to harmless proteins present in the environment. Several common food allergens are structurally similar to pollens that cause seasonal allergies and are present in a wide range of fruits and vegetables. Many of these proteins have been knocked down in plants using RNA interference, leading to plants with reduced allergenicity. As part of our iGarden project we are designing modular BioBrick intron-containing self-complementary hairpin forming RNA (ihpRNA) constructs for the targeted knockdown of proteins with homology to allergens in arabidopsis and strawberry, as well as designing ihpRNA constructs against allergens in a range of other plants common in home gardens, including lettuce, carrots, celery, tomato, and several herbs. Our goal is to use genetic engineering to make food safer, and to specially tailor gardens to the needs of each person with a different set of allergies.


Bibliography

Plant shRNA

  1. Wesley SV, Helliwell CA, Smith NA, Wang MB, Rouse DT, Liu Q, Gooding PS, Singh SP, Abbott D, Stoutjesdijk PA, Robinson SP, Gleave AP, Green AG, and Waterhouse PM. . pmid:11576441. PubMed HubMed [1]
  2. Schwab R, Ossowski S, Riester M, Warthmann N, and Weigel D. . pmid:16531494. PubMed HubMed [2]
All Medline abstracts: PubMed HubMed

Allergen silencing

  1. Dodo HW, Konan KN, Chen FC, Egnin M, and Viquez OM. . pmid:17784907. PubMed HubMed [3]
  2. Singh MB and Bhalla PL. . pmid:18467156. PubMed HubMed [4]
  3. Le LQ, Mahler V, Lorenz Y, Scheurer S, Biemelt S, Vieths S, and Sonnewald U. . pmid:17088146. PubMed HubMed [5]
  4. Gallo M and Sayre R. . pmid:19356919. PubMed HubMed [6]
  5. Lorenz Y, Enrique E, Lequynh L, Fötisch K, Retzek M, Biemelt S, Sonnewald U, Vieths S, and Scheurer S. . pmid:16950292. PubMed HubMed [7]
  6. Herman EM, Helm RM, Jung R, and Kinney AJ. . pmid:12746509. PubMed HubMed [8]
  7. Gilissen LJ, Bolhaar ST, Matos CI, Rouwendal GJ, Boone MJ, Krens FA, Zuidmeer L, Van Leeuwen A, Akkerdaas J, Hoffmann-Sommergruber K, Knulst AC, Bosch D, Van de Weg WE, and Van Ree R. . pmid:15696096. PubMed HubMed [9]
  8. Bhalla PL and Singh MB. . pmid:14962769. PubMed HubMed [10]
All Medline abstracts: PubMed HubMed

Allergen proteins

  1. Chardin H, Mayer C, Sénéchal H, Wal JM, Poncet P, Desvaux FX, and Peltre G. . pmid:12811016. PubMed HubMed [11]
  2. San Miguel-Moncín M, Krail M, Scheurer S, Enrique E, Alonso R, Conti A, Cisteró-Bahíma A, and Vieths S. . pmid:12757453. PubMed HubMed [12]
  3. Salcedo G, Sanchez-Monge R, Diaz-Perales A, Garcia-Casado G, and Barber D. . pmid:15347364. PubMed HubMed [13]
  4. Gajhede M, Osmark P, Poulsen FM, Ipsen H, Larsen JN, Joost van Neerven RJ, Schou C, Løwenstein H, and Spangfort MD. . pmid:8946858. PubMed HubMed [14]
  5. Zuidmeer L, Salentijn E, Rivas MF, Mancebo EG, Asero R, Matos CI, Pelgrom KT, Gilissen LJ, and van Ree R. . pmid:16650053. PubMed HubMed [15]
  6. Karlsson AL, Alm R, Ekstrand B, Fjelkner-Modig S, Schiött A, Bengtsson U, Björk L, Hjernø K, Roepstorff P, and Emanuelsson CS. . pmid:15507096. PubMed HubMed [16]
  7. Musidlowska-Persson A, Alm R, and Emanuelsson C. . pmid:16945416. PubMed HubMed [17]
  8. Breiteneder H and Ebner C. . pmid:10887301. PubMed HubMed [18]
  9. Jensen-Jarolim E, Schmid B, Bernier F, Berna A, Kinaciyan T, Focke M, Ebner C, Scheiner O, and Boltz-Nitulescu G. . pmid:12169176. PubMed HubMed [19]
All Medline abstracts: PubMed HubMed


Primers and Sequences

name GenBank Accession forward sense primer reverse sense primer forward antisense primer reverse antisense primer
pdk intron AJ311872 CCTTGAATTCGCGGCCGCATCTAGA CCAATTGGTAAGGAAATAAT AAGGCTGCAGCGGCCGCTACTAGT TTCGAACCCAATTTCCCAAC
PME3 intron (746 bp) AF033204 CCTTGAATTCGCGGCCGCATCTAGA CTCCGCCACCGTTGGTAAGC AAGGCTGCAGCGGCCGCTACTAGT CGACGGACCCGCCGTGTTTT
PAL2 intron (240 bp) L33678.1 CCTTGAATTCGCGGCCGCATCTAGA ACAGAACTCATTAGGTAATT AAGGCTGCAGCGGCCGCTACTAGT TCCGGCGTTCAAAAATCTGA
GFP AF218816.1 CCTTGAATTCGCGGCCGCATCTAGA atggtgagcaagggcgagga AAGGCTGCAGCGGCCGCTACTAGT gaagatggtgcgctcctgga AAGGCTGCAGCGGCCGCTACTAGT atggtgagcaagggcgagga CCTTGAATTCGCGGCCGCATCTAGA gaagatggtgcgctcctgga
A. thaliana LTP1 ATHSEQB CCTTGAATTCGCGGCCGCATCTAGA ATGGCTGGAGTGATGAAGTT AAGGCTGCAGCGGCCGCTACTAGT CAGCTGCACGGCCAGCGTTG AAGGCTGCAGCGGCCGCTACTAGT ATGGCTGGAGTGATGAAGTT CCTTGAATTCGCGGCCGCATCTAGA CAGCTGCACGGCCAGCGTTG
Fra a 1A (Bet v 1) DQ385511 CCTTGAATTCGCGGCCGCATCTAGA ATGGGTGTTTACACTTATGA AAGGCTGCAGCGGCCGCTACTAGT GTAGTCGATCTTCTCGATGT AAGGCTGCAGCGGCCGCTACTAGT ATGGGTGTTTACACTTATGA CCTTGAATTCGCGGCCGCATCTAGA GTAGTCGATCTTCTCGATGT
L. sativa LTP 1.1 EF101532.1 CCTTGAATTCGCGGCCGCATCTAGA ATGGCAAGGATGGCAACGAT AAGGCTGCAGCGGCCGCTACTAGT TGACACCACACTTGCCGGGG AAGGCTGCAGCGGCCGCTACTAGT ATGGCAAGGATGGCAACGAT CCTTGAATTCGCGGCCGCATCTAGA TGACACCACACTTGCCGGGG
L. sativa LTP 1.2 EF101531.1 CCTTGAATTCGCGGCCGCATCTAGA GTGACATGTGGTCAGGTGGT AAGGCTGCAGCGGCCGCTACTAGT CTGGATCCTATTGCAGTCGG AAGGCTGCAGCGGCCGCTACTAGT GTGACATGTGGTCAGGTGGT CCTTGAATTCGCGGCCGCATCTAGA CTGGATCCTATTGCAGTCGG
S. lycopersicum Lyc E 1.01 (profilin) AJ417553 CCTTGAATTCGCGGCCGCATCTAGA ATGTCGTGGCAAACATATGT AAGGCTGCAGCGGCCGCTACTAGT AGCCTGATTGGTCTTCTTAA AAGGCTGCAGCGGCCGCTACTAGT ATGTCGTGGCAAACATATGT CCTTGAATTCGCGGCCGCATCTAGA AGCCTGATTGGTCTTCTTAA
D. Carota Dau C 1 Z84376.1 CCTTGAATTCGCGGCCGCATCTAGA ATGGGTGCCCAGAGCCATTCAC AAGGCTGCAGCGGCCGCTACTAGT GGTTTCAATGGATTCGATGA AAGGCTGCAGCGGCCGCTACTAGT ATGGGTGCCCAGAGCCATTCAC CCTTGAATTCGCGGCCGCATCTAGA GGTTTCAATGGATTCGATGA
Api g 4 (celery profilin) AF129423.1 CCTTGAATTCGCGGCCGCATCTAGA ATGTCGTGGCAGGCGTACGT AAGGCTGCAGCGGCCGCTACTAGT GGTTCATCATAGACTCCGAA AAGGCTGCAGCGGCCGCTACTAGT ATGTCGTGGCAGGCGTACGT CCTTGAATTCGCGGCCGCATCTAGA GGTTCATCATAGACTCCGAA
Api g 1.0201 (celery) Z75662.2 CCTTGAATTCGCGGCCGCATCTAGA ATGGGTGTCCAAAAGACCGT AAGGCTGCAGCGGCCGCTACTAGT CACCACTGACTCGAGTACGT AAGGCTGCAGCGGCCGCTACTAGT ATGGGTGTCCAAAAGACCGT CCTTGAATTCGCGGCCGCATCTAGA CACCACTGACTCGAGTACGT
Api g 1 (celery) Z48967.1 CCTTGAATTCGCGGCCGCATCTAGA ATGGGAGTGCAGACACATGT AAGGCTGCAGCGGCCGCTACTAGT GTTTTCAATGGATTCGATAA AAGGCTGCAGCGGCCGCTACTAGT ATGGGAGTGCAGACACATGT CCTTGAATTCGCGGCCGCATCTAGA GTTTTCAATGGATTCGATAA
A. Thaliana (BLAST) Bet v 1 (#1) :12937059-12937689 CCTTGAATTCGCGGCCGCATCTAGA ATGATAGAAGAGGAGATTGA AAGGCTGCAGCGGCCGCTACTAGT TACCATATTAAAAAATACGT AAGGCTGCAGCGGCCGCTACTAGT ATGATAGAAGAGGAGATTGA CCTTGAATTCGCGGCCGCATCTAGA TACCATATTAAAAAATACGT
A. Thaliana (BLAST) Bet v 1 (#2) :12937059-12937689 CCTTGAATTCGCGGCCGCATCTAGA AAATTCATTTATAAACGCAT AAGGCTGCAGCGGCCGCTACTAGT TTAATCCTTAGACAAGAGGT AAGGCTGCAGCGGCCGCTACTAGT AAATTCATTTATAAACGCAT CCTTGAATTCGCGGCCGCATCTAGA TTAATCCTTAGACAAGAGGT
A. thaliana GER3 NM_122070 CCTTGAATTCGCGGCCGCATCTAGA ATGAAGATGATAATCCAAAT AAGGCTGCAGCGGCCGCTACTAGT GATGACACCACCACCGGCTA AAGGCTGCAGCGGCCGCTACTAGT ATGAAGATGATAATCCAAAT CCTTGAATTCGCGGCCGCATCTAGA GATGACACCACCACCGGCTA
Fra a 1 Exon2 (for hair pin) DQ385511 CCTTGAATTCGCGGCCGCATCTAGA GCAGCCACTACGGGTACGTC AAGGCTGCAGCGGCCGCTACTAGT TTAGTTGTATTCGCTGGGGT AAGGCTGCAGCGGCCGCTACTAGT GCAGCCACTACGGGTACGTC CCTTGAATTCGCGGCCGCATCTAGA TTAGTTGTATTCGCTGGGGT
Fra a 1 intron DQ385511 CCTTGAATTCGCGGCCGCATCTAGA ATCACCTTTGGTGAAGGTAT AAGGCTGCAGCGGCCGCTACTAGT ACCCGTAGTGGCTGCCTGTC AAGGCTGCAGCGGCCGCTACTAGT ATCACCTTTGGTGAAGGTAT CCTTGAATTCGCGGCCGCATCTAGA ACCCGTAGTGGCTGCCTGTC

Protocols

Isolating Genes From Plants

Strawberry Transformation

  1. Schaart JG, Krens FA, Pelgrom KT, Mendes O, and Rouwendal GJ. . pmid:17147614. PubMed HubMed [1]
  2. Oosumi T, Gruszewski HA, Blischak LA, Baxter AJ, Wadl PA, Shuman JL, Veilleux RE, and Shulaev V. . pmid:16320068. PubMed HubMed [2]
  3. Husaini AM. . pmid:19956955. PubMed HubMed [3]
  4. Graham J, McNicol RJ, and Kumar A. . pmid:7581659. PubMed HubMed [4]
All Medline abstracts: PubMed HubMed

amiRNA

Plasmids

Introns

ihpRNA production requires the selection of an intron. We are using PCR to make hairpin parts out of two introns:

Personal tools