IGEM:Harvard/2010/Team Allergy

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Primers and Sequences)
(Primers and Sequences)
Line 180: Line 180:
|''CCTTGAATTCGCGGCCGCATCTAGA'' CCCACAAACACACGCTCGGA
|''CCTTGAATTCGCGGCCGCATCTAGA'' CCCACAAACACACGCTCGGA
|''AAGGCTGCAGCGGCCGCTACTAGT'' CCCCATGGCGATGCCTTAAA
|''AAGGCTGCAGCGGCCGCTACTAGT'' CCCCATGGCGATGCCTTAAA
 +
]}
==Protocols==
==Protocols==

Revision as of 09:35, 22 June 2010

Contents

Description

Allergies to fruits and vegetables are (increasingly) common, affecting millions of people around the world with symptoms ranging from mild itchiness to life-threatening anaphylaxis. Allergy is caused by an inappropriate immune response to harmless proteins present in the environment. Several common food allergens are structurally similar to pollens that cause seasonal allergies and are present in a wide range of fruits and vegetables. Many of these proteins have been knocked down in plants using RNA interference, leading to plants with reduced allergenicity. As part of our iGarden project we are designing modular BioBrick intron-containing self-complementary hairpin forming RNA (ihpRNA) constructs for the targeted knockdown of proteins with homology to allergens in arabidopsis and strawberry, as well as designing ihpRNA constructs against allergens in a range of other plants common in home gardens, including lettuce, carrots, celery, tomato, and several herbs. Our goal is to use genetic engineering to make food safer, and to specially tailor gardens to the needs of each person with a different set of allergies.


Bibliography

Plant shRNA

Error fetching PMID 11576441:
Error fetching PMID 16531494:
  1. Error fetching PMID 11576441: [1]
  2. Error fetching PMID 16531494: [2]
All Medline abstracts: PubMed HubMed

Allergen silencing

Error fetching PMID 17784907:
Error fetching PMID 18467156:
Error fetching PMID 17088146:
Error fetching PMID 19356919:
Error fetching PMID 16950292:
Error fetching PMID 12746509:
Error fetching PMID 15696096:
Error fetching PMID 14962769:
  1. Error fetching PMID 17784907: [3]
  2. Error fetching PMID 18467156: [4]
  3. Error fetching PMID 17088146: [5]
  4. Error fetching PMID 19356919: [6]
  5. Error fetching PMID 16950292: [7]
  6. Error fetching PMID 12746509: [8]
  7. Error fetching PMID 15696096: [9]
  8. Error fetching PMID 14962769: [10]
All Medline abstracts: PubMed HubMed

Allergen proteins

Error fetching PMID 12811016:
Error fetching PMID 12757453:
Error fetching PMID 15347364:
Error fetching PMID 8946858:
Error fetching PMID 16650053:
Error fetching PMID 15507096:
Error fetching PMID 16945416:
Error fetching PMID 10887301:
Error fetching PMID 12169176:
  1. Error fetching PMID 12811016: [11]
  2. Error fetching PMID 12757453: [12]
  3. Error fetching PMID 15347364: [13]
  4. Error fetching PMID 8946858: [14]
  5. Error fetching PMID 16650053: [15]
  6. Error fetching PMID 15507096: [16]
  7. Error fetching PMID 16945416: [17]
  8. Error fetching PMID 10887301: [18]
  9. Error fetching PMID 12169176: [19]
All Medline abstracts: PubMed HubMed


Primers and Sequences

ihpRNA

name GenBank Accession forward sense primer reverse sense primer forward antisense primer reverse antisense primer
pdk intron AJ311872 CCTTGAATTCGCGGCCGCATCTAGA CCAATTGGTAAGGAAATAAT AAGGCTGCAGCGGCCGCTACTAGT TTCGAACCCAATTTCCCAAC
PME3 intron (746 bp) AF033204 CCTTGAATTCGCGGCCGCATCTAGA CTCCGCCACCGTTGGTAAGC AAGGCTGCAGCGGCCGCTACTAGT CGACGGACCCGCCGTGTTTT
PAL2 intron (240 bp) L33678.1 CCTTGAATTCGCGGCCGCATCTAGA ACAGAACTCATTAGGTAATT AAGGCTGCAGCGGCCGCTACTAGT TCCGGCGTTCAAAAATCTGA
GFP AF218816.1 CCTTGAATTCGCGGCCGCATCTAGA atggtgagcaagggcgagga AAGGCTGCAGCGGCCGCTACTAGT gaagatggtgcgctcctgga AAGGCTGCAGCGGCCGCTACTAGT atggtgagcaagggcgagga CCTTGAATTCGCGGCCGCATCTAGA gaagatggtgcgctcctgga
A. thaliana LTP1 ATHSEQB CCTTGAATTCGCGGCCGCATCTAGA ATGGCTGGAGTGATGAAGTT AAGGCTGCAGCGGCCGCTACTAGT CAGCTGCACGGCCAGCGTTG AAGGCTGCAGCGGCCGCTACTAGT ATGGCTGGAGTGATGAAGTT CCTTGAATTCGCGGCCGCATCTAGA CAGCTGCACGGCCAGCGTTG
Fra a 1A (Bet v 1) DQ385511 CCTTGAATTCGCGGCCGCATCTAGA ATGGGTGTTTACACTTATGA AAGGCTGCAGCGGCCGCTACTAGT GTAGTCGATCTTCTCGATGT AAGGCTGCAGCGGCCGCTACTAGT ATGGGTGTTTACACTTATGA CCTTGAATTCGCGGCCGCATCTAGA GTAGTCGATCTTCTCGATGT
L. sativa LTP 1.1 EF101532.1 CCTTGAATTCGCGGCCGCATCTAGA ATGGCAAGGATGGCAACGAT AAGGCTGCAGCGGCCGCTACTAGT TGACACCACACTTGCCGGGG AAGGCTGCAGCGGCCGCTACTAGT ATGGCAAGGATGGCAACGAT CCTTGAATTCGCGGCCGCATCTAGA TGACACCACACTTGCCGGGG
L. sativa LTP 1.2 EF101531.1 CCTTGAATTCGCGGCCGCATCTAGA GTGACATGTGGTCAGGTGGT AAGGCTGCAGCGGCCGCTACTAGT CTGGATCCTATTGCAGTCGG AAGGCTGCAGCGGCCGCTACTAGT GTGACATGTGGTCAGGTGGT CCTTGAATTCGCGGCCGCATCTAGA CTGGATCCTATTGCAGTCGG
S. lycopersicum Lyc E 1.01 (profilin) AJ417553 CCTTGAATTCGCGGCCGCATCTAGA ATGTCGTGGCAAACATATGT AAGGCTGCAGCGGCCGCTACTAGT AGCCTGATTGGTCTTCTTAA AAGGCTGCAGCGGCCGCTACTAGT ATGTCGTGGCAAACATATGT CCTTGAATTCGCGGCCGCATCTAGA AGCCTGATTGGTCTTCTTAA
D. Carota Dau C 1 Z84376.1 CCTTGAATTCGCGGCCGCATCTAGA ATGGGTGCCCAGAGCCATTCAC AAGGCTGCAGCGGCCGCTACTAGT GGTTTCAATGGATTCGATGA AAGGCTGCAGCGGCCGCTACTAGT ATGGGTGCCCAGAGCCATTCAC CCTTGAATTCGCGGCCGCATCTAGA GGTTTCAATGGATTCGATGA
Api g 4 (celery profilin) AF129423.1 CCTTGAATTCGCGGCCGCATCTAGA ATGTCGTGGCAGGCGTACGT AAGGCTGCAGCGGCCGCTACTAGT GGTTCATCATAGACTCCGAA AAGGCTGCAGCGGCCGCTACTAGT ATGTCGTGGCAGGCGTACGT CCTTGAATTCGCGGCCGCATCTAGA GGTTCATCATAGACTCCGAA
Api g 1.0201 (celery) Z75662.2 CCTTGAATTCGCGGCCGCATCTAGA ATGGGTGTCCAAAAGACCGT AAGGCTGCAGCGGCCGCTACTAGT CACCACTGACTCGAGTACGT AAGGCTGCAGCGGCCGCTACTAGT ATGGGTGTCCAAAAGACCGT CCTTGAATTCGCGGCCGCATCTAGA CACCACTGACTCGAGTACGT
Api g 1 (celery) Z48967.1 CCTTGAATTCGCGGCCGCATCTAGA ATGGGAGTGCAGACACATGT AAGGCTGCAGCGGCCGCTACTAGT GTTTTCAATGGATTCGATAA AAGGCTGCAGCGGCCGCTACTAGT ATGGGAGTGCAGACACATGT CCTTGAATTCGCGGCCGCATCTAGA GTTTTCAATGGATTCGATAA
A. Thaliana (BLAST) Bet v 1 (#1) :12937059-12937689 CCTTGAATTCGCGGCCGCATCTAGA ATGATAGAAGAGGAGATTGA AAGGCTGCAGCGGCCGCTACTAGT TACCATATTAAAAAATACGT AAGGCTGCAGCGGCCGCTACTAGT ATGATAGAAGAGGAGATTGA CCTTGAATTCGCGGCCGCATCTAGA TACCATATTAAAAAATACGT
A. Thaliana (BLAST) Bet v 1 (#2) :12937059-12937689 CCTTGAATTCGCGGCCGCATCTAGA AAATTCATTTATAAACGCAT AAGGCTGCAGCGGCCGCTACTAGT TTAATCCTTAGACAAGAGGT AAGGCTGCAGCGGCCGCTACTAGT AAATTCATTTATAAACGCAT CCTTGAATTCGCGGCCGCATCTAGA TTAATCCTTAGACAAGAGGT
A. thaliana GER3 NM_122070 CCTTGAATTCGCGGCCGCATCTAGA ATGAAGATGATAATCCAAAT AAGGCTGCAGCGGCCGCTACTAGT GATGACACCACCACCGGCTA AAGGCTGCAGCGGCCGCTACTAGT ATGAAGATGATAATCCAAAT CCTTGAATTCGCGGCCGCATCTAGA GATGACACCACCACCGGCTA
Fra a 1 Exon2 (for hair pin) DQ385511 CCTTGAATTCGCGGCCGCATCTAGA GCAGCCACTACGGGTACGTC AAGGCTGCAGCGGCCGCTACTAGT TTAGTTGTATTCGCTGGGGT AAGGCTGCAGCGGCCGCTACTAGT GCAGCCACTACGGGTACGTC CCTTGAATTCGCGGCCGCATCTAGA TTAGTTGTATTCGCTGGGGT
Fra a 1 intron DQ385511 CCTTGAATTCGCGGCCGCATCTAGA ATCACCTTTGGTGAAGGTAT AAGGCTGCAGCGGCCGCTACTAGT ACCCGTAGTGGCTGCCTGTC AAGGCTGCAGCGGCCGCTACTAGT ATCACCTTTGGTGAAGGTAT CCTTGAATTCGCGGCCGCATCTAGA ACCCGTAGTGGCTGCCTGTC

amiRNA

forward reverse
CCTTGAATTCGCGGCCGCATCTAGA CCCACAAACACACGCTCGGA AAGGCTGCAGCGGCCGCTACTAGT CCCCATGGCGATGCCTTAAA

]}

Protocols

Isolating Genes From Plants

Strawberry Transformation

Error fetching PMID 17147614:
Error fetching PMID 16320068:
Error fetching PMID 19956955:
Error fetching PMID 7581659:
  1. Error fetching PMID 17147614: [1]
  2. Error fetching PMID 16320068: [2]
  3. Error fetching PMID 19956955: [3]
  4. Error fetching PMID 7581659: [4]
All Medline abstracts: PubMed HubMed

amiRNA

Plasmids

Introns

ihpRNA production requires the selection of an intron. We are using PCR to make hairpin parts out of two introns:

Personal tools