IGEM:IMPERIAL/2006/project/primers/Cre Lox: Difference between revisions

Revision as of 07:54, 28 October 2006

Primer 1

Primer 1 is the same as the sense streand and consists of
- Restriction Sites – Lox Site – Stop Codon – First 20 bases of part B0021

GAATTCGCGGCCGCTTCTAGAGCGATAACTTGGTATAGCATACATTATACGAACGGTATGAAAATAATAAAAAAGCGG

Primer 2

We need both the sense strand and the anti-sense strand for this primer
- 31bp into part B0021 (long due to a run of T and A)
- 22Bp into part I13521

Same as Sense Strand :

cggattaataatctggctttttatattctcttataaacgcagaaaggcccacc

Reversed And Complemantry

GGTGGGCCTTTCTGCGTTTATAAGAGAATATAAAAAGCCAGATTATTAATCCG

Primer 3

Primer 3 contans a section complemantry to the sense strand of the construct and a lox site and some restriction sites. It was made by copying the end of the desired sense strand and making it complementary and reversing it.

CTGCAGCGGCCGCTACTAGTAATAACTTCGTATAATGTATCGTATACGAACGGTAACTCCCTATCAGTGATAGAGATTGACATCC

@@ Line 1: / Line 1: @@
+'''Primer 1'''
+*Primer 1 is the same as the sense streand and consists of
+**Restriction Sites – Lox Site – Stop Codon – First 20 bases of part B0021
+GAATTCGCGGCCGCTTCTAGAGCGATAACTTGGTATAGCATACATTATACGAACGGTATGAAAATAATAAAAAAGCGG
+'''Primer 2'''
+*We need both the sense strand and the anti-sense strand for this primer
+**31bp into part B0021 (long due to a run of T and A)
+**22Bp into part I13521
+Same as Sense Strand :
+cggattaataatctggctttttatattctcttataaacgcagaaaggcccacc
+Reversed And Complemantry
+GGTGGGCCTTTCTGCGTTTATAAGAGAATATAAAAAGCCAGATTATTAATCCG
+'''Primer 3'''
+*Primer 3 contans a section complemantry to the sense strand of the construct and a lox site and some restriction sites. It was made by copying the end of the desired sense strand and making it complementary and reversing it.
+CTGCAGCGGCCGCTACTAGTAATAACTTCGTATAATGTATCGTATACGAACGGTAACTCCCTATCAGTGATAGAGATTGACATCC
 [[Image:Redoing Cre.pdf]]
-The Cre containing plasmid will be bought and here is it's datasheet
 [[Image:A112-705-Cre Version 2 1.pdf]]