IGEM:IMPERIAL/2006/project/primers/Cre Lox

From OpenWetWare

< IGEM:IMPERIAL | 2006 | project | primers
Revision as of 11:11, 28 October 2006 by Jonny (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search

Primer 1

  • Primer 1 is the same as the sense streand and consists of
    • Restriction Sites – Lox Site – Stop Codon – First 20 bases of part B0021

GAATTCGCGGCCGCTTCTAGAGCGATAACTTGGTATAGCATACATTATACGAACGGTATGAAAATAATAAAAAAGCGG

Primer 2

  • We need both the sense strand and the anti-sense strand for this primer
    • 31bp into part B0021 (long due to a run of T and A)
    • 22bp into part I13521


Sense Strand :

CGGATTAATAATCTGGCTTTTTATATTCTCTTATAAACGCAGAAAGGCCCACC


Antisense Strand:

GGTGGGCCTTTCTGCGTTTATAAGAGAATATAAAAAGCCAGATTATTAATCCG


Primer 3

  • Primer 3 contans a section complementary to the sense strand of the construct and a Lox site and some restriction sites. It was made by copying the end of the desired sense strand and making it complementary and reversing it.


CTGCAGCGGCCGCTACTAGTAATAACTTCGTATAATGTATCGTATACGAACGGTAACTCCCTATCAGTGATAGAGATTGACATCC


For further information on incorporation [here]

Personal tools