IGEM:IMPERIAL/2006/project/primers/aiia

We are trying to put a immuno tag onto aiia and these are the PCR primers which we think will work

The primer at the 5’ end of the coding strand is the same as the coding strand.

______________________ = RESTRICTION SITES
                      ___________________________ = Immuno TAG
                                                 _____________________ = same as start of gene (ie. binds to - strand)
gaattcgcggccgcttctagagGATTATAAAGATGATGATGATAAAGGTatgacagtaaagaagctttat

This was orderd orrignally and is right

Problem

This Primer was ordered

_______________  = complemantary to end of gene (ie. binds to + strand)  
               _____________________ = RESTRICTION SITES (complementary to + sequence)
aatcatcgaattattatgatcatcgccggcgacgtc

This primer should be complementary to the coding strand so the coding strand made from this primer will be

Primer           aatcatcgaattattatgatcatcgccggcgacgtc
Sequence Created GACGTCGCCGGCGATGATCATAATAATTCGATGATT

There are no restriction sites for spe1 and pst1.

The restriction sites can be cut by 
Name	 Sequence 	SiteLength 	Overhang 	Frequency 	Cut Positions
NaeI 	GCCGGC 	           6 		blunt 			1 		9 
AcyI 	GRCGYC             6 		five_prime 		1		 2 
BclI 	TGATCA 	           6 		five_prime 		1		 15 
Cfr10I	RCCGGY 	           6 		five_prime 		1		 7 
SgrAI 	CRCCGGYG 	   8 		five_prime 		1		 7 
AatII 	GACGTC 	           6 		three_prime 		1		 5 
Hpy99I CGWCG 	           5 		three_prime 		1		 7

However none of these are complementary to any of the registary restriction enzymes so new primers must be ordered.

Redisigning the primers

End of desired AiiA gene

cgaaaactacgctttagtagcttaataaTACTAGTAGCGGCCGCTGCAG 3’
					  
			    Spe1	   ------ pst1

Order the Reverse and complement

CTGCAGCGGCCGCTACTAGTATTATTAAGCTACTAAAGCGTAGTTTTCG