IGEM:IMPERIAL/2006/project/primers/aiia: Difference between revisions
No edit summary |
No edit summary |
||
| (5 intermediate revisions by one other user not shown) | |||
| Line 4: | Line 4: | ||
'''We are using this primer''' | |||
______________________ = RESTRICTION SITES | ______________________ = RESTRICTION SITES | ||
___________________________ = Immuno TAG | ___________________________ = Immuno TAG | ||
| Line 24: | Line 25: | ||
Sequence Created GACGTCGCCGGCGATGATCATAATAATTCGATGATT | Sequence Created GACGTCGCCGGCGATGATCATAATAATTCGATGATT | ||
'''There are no restriction sites for spe1 and pst1.''' | |||
'''The restriction sites can be cut by''' | |||
Name Sequence SiteLength Overhang Frequency Cut Positions | |||
NaeI GCCGGC 6 blunt 1 9 | |||
AcyI GRCGYC 6 five_prime 1 2 | |||
BclI TGATCA 6 five_prime 1 15 | |||
Cfr10I RCCGGY 6 five_prime 1 7 | |||
SgrAI CRCCGGYG 8 five_prime 1 7 | |||
AatII GACGTC 6 three_prime 1 5 | |||
Hpy99I CGWCG 5 three_prime 1 7 | |||
However none of these are complementary to any of the registary restriction enzymes so new primers must be ordered. | |||
'''Redisigning the primers''' | |||
End of desired AiiA gene | |||
CTGCAGCGGCCGCTACTAGTATTATTAAGCTACTAAAGCGTAGTTTTCG | cgaaaactacgctttagtagcttaataaTACTAGTAGCGGCCGCTGCAG 3’ | ||
Spe1 ------ pst1 | |||
'''Order the Reverse and complement''' | |||
'''We are usin this primer''' | |||
CTGCAGCGGCCGCTACTAGTATTATTAAGCTACTAAAGCGTAGTTTTCG | |||
This should work | |||
==Sequencing aiiA== | |||
We are sequencing from the plasmid into the part in both directions, This should give us two overlapping sequences which we can align to get the full sequence of the promoters, RBS, Terminators and protein. | |||
[[Image:Sequencing.JPG]] | |||
[[User:JohnChattaway|JohnChattaway]] 12:36, 21 August 2006 (EDT) | |||
Latest revision as of 08:12, 28 October 2006
We are trying to put a immuno tag onto aiia and these are the PCR primers which we think will work
The primer at the 5’ end of the coding strand is the same as the coding strand.
We are using this primer
______________________ = RESTRICTION SITES
___________________________ = Immuno TAG
_____________________ = same as start of gene (ie. binds to - strand)
gaattcgcggccgcttctagagGATTATAAAGATGATGATGATAAAGGTatgacagtaaagaagctttat
This was orderd orrignally and is right
Problem
This Primer was ordered
_______________ = complemantary to end of gene (ie. binds to + strand)
_____________________ = RESTRICTION SITES (complementary to + sequence)
aatcatcgaattattatgatcatcgccggcgacgtc
This primer should be complementary to the coding strand so the coding strand made from this primer will be
Primer aatcatcgaattattatgatcatcgccggcgacgtc Sequence Created GACGTCGCCGGCGATGATCATAATAATTCGATGATT
There are no restriction sites for spe1 and pst1.
The restriction sites can be cut by Name Sequence SiteLength Overhang Frequency Cut Positions NaeI GCCGGC 6 blunt 1 9 AcyI GRCGYC 6 five_prime 1 2 BclI TGATCA 6 five_prime 1 15 Cfr10I RCCGGY 6 five_prime 1 7 SgrAI CRCCGGYG 8 five_prime 1 7 AatII GACGTC 6 three_prime 1 5 Hpy99I CGWCG 5 three_prime 1 7
However none of these are complementary to any of the registary restriction enzymes so new primers must be ordered.
Redisigning the primers
End of desired AiiA gene
cgaaaactacgctttagtagcttaataaTACTAGTAGCGGCCGCTGCAG 3’ Spe1 ------ pst1
Order the Reverse and complement
We are usin this primer CTGCAGCGGCCGCTACTAGTATTATTAAGCTACTAAAGCGTAGTTTTCG
This should work
Sequencing aiiA
We are sequencing from the plasmid into the part in both directions, This should give us two overlapping sequences which we can align to get the full sequence of the promoters, RBS, Terminators and protein.
JohnChattaway 12:36, 21 August 2006 (EDT)
