IGEM:IMPERIAL/2006/project/primers/aiia
From OpenWetWare
We are trying to put a immuno tag onto aiia and these are the PCR primers which we think will work
The primer at the 5’ end of the coding strand is the same as the coding strand.
We are using this primer ______________________ = RESTRICTION SITES ___________________________ = Immuno TAG _____________________ = same as start of gene (ie. binds to - strand) gaattcgcggccgcttctagagGATTATAAAGATGATGATGATAAAGGTatgacagtaaagaagctttat
This was orderd orrignally and is right
Problem
This Primer was ordered
_______________ = complemantary to end of gene (ie. binds to + strand) _____________________ = RESTRICTION SITES (complementary to + sequence) aatcatcgaattattatgatcatcgccggcgacgtc
This primer should be complementary to the coding strand so the coding strand made from this primer will be
Primer aatcatcgaattattatgatcatcgccggcgacgtc Sequence Created GACGTCGCCGGCGATGATCATAATAATTCGATGATT
There are no restriction sites for spe1 and pst1.
The restriction sites can be cut by Name Sequence SiteLength Overhang Frequency Cut Positions NaeI GCCGGC 6 blunt 1 9 AcyI GRCGYC 6 five_prime 1 2 BclI TGATCA 6 five_prime 1 15 Cfr10I RCCGGY 6 five_prime 1 7 SgrAI CRCCGGYG 8 five_prime 1 7 AatII GACGTC 6 three_prime 1 5 Hpy99I CGWCG 5 three_prime 1 7
However none of these are complementary to any of the registary restriction enzymes so new primers must be ordered.
Redisigning the primers
End of desired AiiA gene
cgaaaactacgctttagtagcttaataaTACTAGTAGCGGCCGCTGCAG 3’ Spe1 ------ pst1
Order the Reverse and complement
We are usin this primer CTGCAGCGGCCGCTACTAGTATTATTAAGCTACTAAAGCGTAGTTTTCG
This should work
JohnChattaway 12:36, 21 August 2006 (EDT)